Summary Sequence Alignment 16S rRNA Context  
4 homologues found:

HomologuedndB
OrganismVibrio cholerae MZO-3
GID1023
PID2023
Locus tagA51_B0787
Locations82142..83221
Length1080 bp
G+C%41
Link NCBI: gi:118585852  
SequenceATGCACAATCAAGATTCCGGCTATTGCTACTCATTCCCTGCGGTTAGAGGTATTCAAGCCGGGCGACCAT
TTTACATCGCGACTTGTCCTCTACGGATTATCCCCAAAATTTTTAGTTACAACGAAGATGATGTTCCACC
CGAATTACGAGCACAAAGAACATTAAATAAGACCCGTATTCCAGAAATGGTGAGGTACTTACTTGATAAT
CCAAAGGATTATGTCTTTTCAGCGTTAACCGCATCAGTAGGAATTGATATCTGTTTCGAAGACCACGATG
GAGCTCCAAATCTAGGAATCCTAAAAATTCCCATGGACGCTCAAATATTGATCAACGATGGTCAACATAG
ACGTAAAGCTATCGAAGAAGCGCTACGAGAAAATCCAGACTTAGGGCAAGACAACATTCCAGTGCTATTT
TTTGTCGATGAAGGCTTAAAACGTAGCCAGCAAATGTTTGCGGATCTCAATAAATACGCAGTAAAACCTA
GCCCTTCTTTAGGGGTTTTATACGACCTTAGAGATGAAAGCTCGGAGCTCGCGAGAAGATTGGCTACTCA
CTGTATGCCTTTTATCGGCTTAACTGAGATGGAAAAATCGAATATCAGCCCTAAATCGAACAAACTTTTT
ACTTTGAGTAGTATCAAACAAGCCACAAGAGCTCTTCTTGGAAAAGGGGCAAAAGATGGTTTTACAAAAG
AAGAAAAAGCATTAGCTGAATCATTTTGGAAAATCGTCGCAGAAAACATGCCTGACTGGCAAATGGTTAT
ATCTAAACAAGTTTCTCCTGCGCAACTTAGACAAGAATATATTCACGCGCACGGGGTCGGCTTGCACGCT
ATTGGGGTCATGGGGAACTCTTTACTCTGTGAAGAGCCTGAAAAATGGGCTGAAAAACTCAAAAAGCTGA
GAAACATAAATTGGCTAAAAACCAACCCTGAATGGATAAAGCGTAGTATGAATCTAGGGAAAGTCAGTAA
ATCTACCCTCAACATTCAACTCACAGCAAACTACTTGAAAATAAGTCTTGCGTTACCGTTAACCCCCGAA
GAAAAAGCTCTAGAGAAGCAGTTATCATGA

HomologuedndC
OrganismVibrio cholerae MZO-3
GID1041
PID2041
Locus tagA51_B0786
Locations80514..82145
Length1632 bp
G+C%43
Link NCBI: gi:118585852  
SequenceATGATACACGAGCTAAAATTGGCGGAAGATCTTGCCGAATACGAAGATTTCATTAATCACGAAGACTTCG
CAAATAACAAACTGAGTCACTACATCGCTGATGTTCAACGGGTTTACTGCGCAGATAAACGCCCATGGGT
CATTGGATACAGTGGTGGTAAAGACTCGTCTGCCGTAATGTCATTGGTTTACATGGCATTACTCGGATTA
GAGCCAAAAGATCGAAGCAAACCTGTTTTTGTTGTCTCCTCGGATACTCTGGTAGAAACCCCTGTAGTGG
TAAACCATATCAAAGACTCATTAAATGCCATTGAAAAAGGTGCCAAACGCGATCTACTACCCATTACCTG
CCACAAAGTGGTACCCGAAAACAACCAAACTTTTTGGGCAAACTTACTAGGTAAGGGCTATCCAGCACCA
ACAAGGTCTTTCCGTTGGTGCACTGAGCGTATGAAAATTGATCCGGTCAGCGACTTTATTAAATCCAAAG
TATCCCAATACGATGAAGTGATCGTTGTATTAGGCTCTCGCAGTCAAGAAAGTGCATCACGTGCACAGGT
CATTGCAAAACATAAGATTGACGGCTCACGTCTCGCGCGCCACACAACATTATCAAATGCTTTTATCTAT
ACGCCGATTGACACATGGGGAGTTGATGATGTTTGGAAAATACTACGCCTTTGCCACCTAGAAACGAAAG
AAACCCCTTACGGTACTAAAAATATCTGGATCGATAAGTATGACCTAGAGTGGGAAAATCCATGGGGAGG
AAAAAACCTAGTCCTCTGGAATTTATATAAAGACTCTTCTGGTCAGGGCGAATGTCCTATGGTCATTGAT
GAGACAACTCCATCTTGCGGTAACTCTCGCTTTGGTTGCTGGACTTGTACCGTCGTAACCAAAGATCGTG
CTATGGAAAGCCTTATCCAAAATGGCGAAGAGTGGATGTCACCACTACTTGAATTTCGCAACAAGTTGTC
CATGACAACAGAACCGGCAAACAAAGAAGAATTTAGAAACTACAAGCGCCGCACTGGAAAAGTGAGCTAT
CAATACGCCAAAGAGGGAGAAGATATTGCTTCTGAGCGCAAGCATGTCCCCGGCCCCTATTGGATGAAAT
ACCGGCAACAATGGCTGAAAGAGCTACTTGAATTAGACAAAAAATTCAAAAGTGAAGGCCGAGAAATTGA
GTTAATTACCGCCCCTGAATTGCATGCAATTCGTCAAGAGTGGATTCACGATCCAAATGAACCAGATTGG
GATGATTCTCTCCCCATGATATTTAGAGAAGTCTACGGTTACGATCTGGATTGGGTTTATGACGATAACG
CGAGCTTCGGAAAAGGTGACGCCCAACTGATCAGTGAGCTATGTCAGGATTTCGATGTCGAACCAGAAAT
GATCATGAAACTTATTGAGCTTGAAGTTTCTACTGAAGGTTTGAGTAGACGGAATGGCATCTCCAATAAA
ATCGCCTCATTACTAAAACAAGATTGGGGAAGTTTAGAAGAGATCAAACAAAAGCATGCATCGCTACAAA
GCAAAGCTGAATTTGATGTTCATCAGCAAGAGATTGAGCGTTACAACCAGCAGCTTGCCGATCTCGATAA
ACAGCTTCAAAAAGAGTTTTAA

HomologuedndD
OrganismVibrio cholerae MZO-3
GID1059
PID2059
Locus tagA51_B0785
Locations78496..80505
Length2010 bp
G+C%42
Link NCBI: gi:118585852  
SequenceATGTTGATTACAAAGTTAACTTTAAATAATTTCCGAGTTTTCCGCGGTGTACATGAGATTGACTTACGCC
CGGCACCTGCGCGCCTAAGCAAAACTGGACCTGTAGTCGGTACGGAGAGACCCATCATTCTCTTTGGTGG
TCTAAATGGTGCTGGCAAAACATCGATTCTTACTGCGATCCGTCTGGCTCTATTTGGCCGCCTGTCATTC
AGTCAAAATCTTACCAGTAACGATTATGTGGAAGCGCTAGCCGAGCTTATCCATAAAGGTGTTGGTCTCG
GAGGCTTACAAAATAGTGCATCCATAGAATTAGAATTTAAGTACAGCCAAAATGGTGAAGAGAGTGCTTA
TAAGGTTTTAAGAGGTTGGCAACGAGGCAAAAAAGACTACCTTCAGCTTGAAAAAAATGGAATTCCTCTT
TCAGAGCTTAACTACGATCAGTGTCAGGGCTTCCTCAATGAGCTTATTCCAACAGGCATTGCTGATTTGT
TCTTCTTTGACGGTGAAAAAATTGCGGAACTCGCAGAAGATGAGTCCGGGCTCGTCCTAAAAACTGCCGT
ACGTCGGTTATTGGGATTAGATGTTATTGCTAAACTCAAAAGTGACCTCAATATTTTCCTTAAAAAACAA
GGCTCGCAAGCACTCAGCCAATCCTTGAAAGAGGAAATGGAAAATCTCGATAAACTGCGTATAAAACATG
AAAGAAACGCTGAAAAACTGAGAGGTGAGGCAGATATTGTGGATGCCCAAATCGAGCTGGTATCACGAGA
TATTCTTAATTTAGAAAATAAACTGTCTCAAAGCGGTGGAGCTTGGGCTAAGACAAGAGAAGATGAGCAA
CAAAAAGTAGATGCTTTACTCAAAGAGAAAGTGGAACTTGAGAAACAAATTCGCATGGAAATGGAGACAA
GTCTTCCATTCGCACTAGCACCCAACGCGATGCAACGTCTGCAAACTCAGATCAAGCAAGAGCAAGAGAT
TAAGAAGAAGCAGAGCTTTGGCAATGAGCTCGATTCATTCTTAGAAACTTTGCGATCAAAGTATCCAAGC
TTTGATACAGAAAAGGCTCAACATGCGATTGCTGATAGCTTTAAAGCACACGTGGGTGACTTTGATTCGG
CCAAGCTGCTTTTAGATATCTCCGACCGTCAAGCAAATACTATTGACTATCAACTGACTAAGCTTTCTCA
AGACTCTTTTGCACGATTCGATGAAGCGAGAAAACGGCTACAAGTAGTAGAAGAAGATATCGATAATGCT
TCAAACAACATTGCAAGAGCTCCAGAGCAAGAACTGGTACAAGGGCTTTTTTCTGAAGTAAGAAAGCTTG
ATAAGAAGAAAGAGAAGCTGATTATCGGATACCATGAGCTACTGGAAAATGCGAAGCGAGAGTTGAAGTT
GGCATTGGAGACGGCTCGCCAGATTCAAAGGCTTCACGACAAGCATAAAGATGAATCCAACAAAGACTTG
AGTGTAACCAATGCGCAAAGCGCCATTCTTCTGCTCGATAAATTTGCCGAGCAGCTGACTAAAGCGCGAG
TAAAACAGTTAGAAAATGAATTTGTTTCGTCATACAAAAAGCTGGCACGTAAAGAAGATGTGCAGCTCAC
CGCTGCCATCAATCCACTCACATTTGATGTTGAGTTAATGGATGAATACGGGATAAAAATCAATCGTAAA
GCCATGTCTGCTGGAGAAAAGCAAATCTACGCTATCTCCATATTGGAAGCGCTTGGCCGCACATCAGGCC
GTAAGCTGCCGATTATTATTGATACGCCGCTTGGTCGCTTAGATTCCCATCATCGTGACAAACTGGTTGA
AAACTATTTTCCTACAGCGAGTCATCAAGTGGTTATTCTATCGACAGATACCGAAATCGACAGAAATTAC
ACCAACCTTATCCAAGACGATATCGCCAGAACTTATGAGATTTGTTTTGATGGAAAAACGAAATCTTCAA
CGATTAAAGAAGGCTACTTCTGGAGAGAAGCCAATAAGGAGGCCGTGTAA

HomologuedndE
OrganismVibrio cholerae MZO-3
GID1078
PID2078
Locus tagA51_B0784
Locations78149..78496
Length348 bp
G+C%41.3
Link NCBI: gi:118585852   
SequenceATGCTACCTAACCGCATGAACCTCACTCGCACGACTGAAGAGCAGCTTAAAAAGTTGAAGGGTTATACTG
GTATCACTCCAAACATATCGGCACGTATTGCTTTCTTCCGTTCAATAGAAAGTGACTTCCGTTATCAAGG
CCAAGAAGCAAAGTTAGACGGCTCACTTGTGTTGGATAAATACACTTGGCTTGGTGAAACCAGTGATGTC
ACTGAGTTAGTTTTGAAAATGTACTACCCAGAGCTAGACACTAAAGGATACCAGCAAGCATGGGCTGCGC
ATGTTGAAGATGGAATTGCTTCTCTCAGAAACTTTAAAAACATTGAGAAACTATCCAACACATTATAA