Summary Sequence Context  
1 homologue found:

HomologuedndB
OrganismVibrio cholerae MZO-3
GID1023
PID2023
Locus tagA51_B0787
Locations82142..83221
Length1080 bp
G+C%41
Link NCBI: gi:118585852  
SequenceATGCACAATCAAGATTCCGGCTATTGCTACTCATTCCCTGCGGTTAGAGGTATTCAAGCCGGGCGACCAT
TTTACATCGCGACTTGTCCTCTACGGATTATCCCCAAAATTTTTAGTTACAACGAAGATGATGTTCCACC
CGAATTACGAGCACAAAGAACATTAAATAAGACCCGTATTCCAGAAATGGTGAGGTACTTACTTGATAAT
CCAAAGGATTATGTCTTTTCAGCGTTAACCGCATCAGTAGGAATTGATATCTGTTTCGAAGACCACGATG
GAGCTCCAAATCTAGGAATCCTAAAAATTCCCATGGACGCTCAAATATTGATCAACGATGGTCAACATAG
ACGTAAAGCTATCGAAGAAGCGCTACGAGAAAATCCAGACTTAGGGCAAGACAACATTCCAGTGCTATTT
TTTGTCGATGAAGGCTTAAAACGTAGCCAGCAAATGTTTGCGGATCTCAATAAATACGCAGTAAAACCTA
GCCCTTCTTTAGGGGTTTTATACGACCTTAGAGATGAAAGCTCGGAGCTCGCGAGAAGATTGGCTACTCA
CTGTATGCCTTTTATCGGCTTAACTGAGATGGAAAAATCGAATATCAGCCCTAAATCGAACAAACTTTTT
ACTTTGAGTAGTATCAAACAAGCCACAAGAGCTCTTCTTGGAAAAGGGGCAAAAGATGGTTTTACAAAAG
AAGAAAAAGCATTAGCTGAATCATTTTGGAAAATCGTCGCAGAAAACATGCCTGACTGGCAAATGGTTAT
ATCTAAACAAGTTTCTCCTGCGCAACTTAGACAAGAATATATTCACGCGCACGGGGTCGGCTTGCACGCT
ATTGGGGTCATGGGGAACTCTTTACTCTGTGAAGAGCCTGAAAAATGGGCTGAAAAACTCAAAAAGCTGA
GAAACATAAATTGGCTAAAAACCAACCCTGAATGGATAAAGCGTAGTATGAATCTAGGGAAAGTCAGTAA
ATCTACCCTCAACATTCAACTCACAGCAAACTACTTGAAAATAAGTCTTGCGTTACCGTTAACCCCCGAA
GAAAAAGCTCTAGAGAAGCAGTTATCATGA