Summary Sequence Context  
1 homologue found:

HomologuedndC
OrganismVibrio cholerae MZO-3
GID1041
PID2041
Locus tagA51_B0786
Locations80514..82145
Length1632 bp
G+C%43
Link NCBI: gi:118585852  
SequenceATGATACACGAGCTAAAATTGGCGGAAGATCTTGCCGAATACGAAGATTTCATTAATCACGAAGACTTCG
CAAATAACAAACTGAGTCACTACATCGCTGATGTTCAACGGGTTTACTGCGCAGATAAACGCCCATGGGT
CATTGGATACAGTGGTGGTAAAGACTCGTCTGCCGTAATGTCATTGGTTTACATGGCATTACTCGGATTA
GAGCCAAAAGATCGAAGCAAACCTGTTTTTGTTGTCTCCTCGGATACTCTGGTAGAAACCCCTGTAGTGG
TAAACCATATCAAAGACTCATTAAATGCCATTGAAAAAGGTGCCAAACGCGATCTACTACCCATTACCTG
CCACAAAGTGGTACCCGAAAACAACCAAACTTTTTGGGCAAACTTACTAGGTAAGGGCTATCCAGCACCA
ACAAGGTCTTTCCGTTGGTGCACTGAGCGTATGAAAATTGATCCGGTCAGCGACTTTATTAAATCCAAAG
TATCCCAATACGATGAAGTGATCGTTGTATTAGGCTCTCGCAGTCAAGAAAGTGCATCACGTGCACAGGT
CATTGCAAAACATAAGATTGACGGCTCACGTCTCGCGCGCCACACAACATTATCAAATGCTTTTATCTAT
ACGCCGATTGACACATGGGGAGTTGATGATGTTTGGAAAATACTACGCCTTTGCCACCTAGAAACGAAAG
AAACCCCTTACGGTACTAAAAATATCTGGATCGATAAGTATGACCTAGAGTGGGAAAATCCATGGGGAGG
AAAAAACCTAGTCCTCTGGAATTTATATAAAGACTCTTCTGGTCAGGGCGAATGTCCTATGGTCATTGAT
GAGACAACTCCATCTTGCGGTAACTCTCGCTTTGGTTGCTGGACTTGTACCGTCGTAACCAAAGATCGTG
CTATGGAAAGCCTTATCCAAAATGGCGAAGAGTGGATGTCACCACTACTTGAATTTCGCAACAAGTTGTC
CATGACAACAGAACCGGCAAACAAAGAAGAATTTAGAAACTACAAGCGCCGCACTGGAAAAGTGAGCTAT
CAATACGCCAAAGAGGGAGAAGATATTGCTTCTGAGCGCAAGCATGTCCCCGGCCCCTATTGGATGAAAT
ACCGGCAACAATGGCTGAAAGAGCTACTTGAATTAGACAAAAAATTCAAAAGTGAAGGCCGAGAAATTGA
GTTAATTACCGCCCCTGAATTGCATGCAATTCGTCAAGAGTGGATTCACGATCCAAATGAACCAGATTGG
GATGATTCTCTCCCCATGATATTTAGAGAAGTCTACGGTTACGATCTGGATTGGGTTTATGACGATAACG
CGAGCTTCGGAAAAGGTGACGCCCAACTGATCAGTGAGCTATGTCAGGATTTCGATGTCGAACCAGAAAT
GATCATGAAACTTATTGAGCTTGAAGTTTCTACTGAAGGTTTGAGTAGACGGAATGGCATCTCCAATAAA
ATCGCCTCATTACTAAAACAAGATTGGGGAAGTTTAGAAGAGATCAAACAAAAGCATGCATCGCTACAAA
GCAAAGCTGAATTTGATGTTCATCAGCAAGAGATTGAGCGTTACAACCAGCAGCTTGCCGATCTCGATAA
ACAGCTTCAAAAAGAGTTTTAA