Summary Sequence Context  
1 homologue found:

HomologuedndD
OrganismVibrio cholerae MZO-3
GID1059
PID2059
Locus tagA51_B0785
Locations78496..80505
Length2010 bp
G+C%42
Link NCBI: gi:118585852  
SequenceATGTTGATTACAAAGTTAACTTTAAATAATTTCCGAGTTTTCCGCGGTGTACATGAGATTGACTTACGCC
CGGCACCTGCGCGCCTAAGCAAAACTGGACCTGTAGTCGGTACGGAGAGACCCATCATTCTCTTTGGTGG
TCTAAATGGTGCTGGCAAAACATCGATTCTTACTGCGATCCGTCTGGCTCTATTTGGCCGCCTGTCATTC
AGTCAAAATCTTACCAGTAACGATTATGTGGAAGCGCTAGCCGAGCTTATCCATAAAGGTGTTGGTCTCG
GAGGCTTACAAAATAGTGCATCCATAGAATTAGAATTTAAGTACAGCCAAAATGGTGAAGAGAGTGCTTA
TAAGGTTTTAAGAGGTTGGCAACGAGGCAAAAAAGACTACCTTCAGCTTGAAAAAAATGGAATTCCTCTT
TCAGAGCTTAACTACGATCAGTGTCAGGGCTTCCTCAATGAGCTTATTCCAACAGGCATTGCTGATTTGT
TCTTCTTTGACGGTGAAAAAATTGCGGAACTCGCAGAAGATGAGTCCGGGCTCGTCCTAAAAACTGCCGT
ACGTCGGTTATTGGGATTAGATGTTATTGCTAAACTCAAAAGTGACCTCAATATTTTCCTTAAAAAACAA
GGCTCGCAAGCACTCAGCCAATCCTTGAAAGAGGAAATGGAAAATCTCGATAAACTGCGTATAAAACATG
AAAGAAACGCTGAAAAACTGAGAGGTGAGGCAGATATTGTGGATGCCCAAATCGAGCTGGTATCACGAGA
TATTCTTAATTTAGAAAATAAACTGTCTCAAAGCGGTGGAGCTTGGGCTAAGACAAGAGAAGATGAGCAA
CAAAAAGTAGATGCTTTACTCAAAGAGAAAGTGGAACTTGAGAAACAAATTCGCATGGAAATGGAGACAA
GTCTTCCATTCGCACTAGCACCCAACGCGATGCAACGTCTGCAAACTCAGATCAAGCAAGAGCAAGAGAT
TAAGAAGAAGCAGAGCTTTGGCAATGAGCTCGATTCATTCTTAGAAACTTTGCGATCAAAGTATCCAAGC
TTTGATACAGAAAAGGCTCAACATGCGATTGCTGATAGCTTTAAAGCACACGTGGGTGACTTTGATTCGG
CCAAGCTGCTTTTAGATATCTCCGACCGTCAAGCAAATACTATTGACTATCAACTGACTAAGCTTTCTCA
AGACTCTTTTGCACGATTCGATGAAGCGAGAAAACGGCTACAAGTAGTAGAAGAAGATATCGATAATGCT
TCAAACAACATTGCAAGAGCTCCAGAGCAAGAACTGGTACAAGGGCTTTTTTCTGAAGTAAGAAAGCTTG
ATAAGAAGAAAGAGAAGCTGATTATCGGATACCATGAGCTACTGGAAAATGCGAAGCGAGAGTTGAAGTT
GGCATTGGAGACGGCTCGCCAGATTCAAAGGCTTCACGACAAGCATAAAGATGAATCCAACAAAGACTTG
AGTGTAACCAATGCGCAAAGCGCCATTCTTCTGCTCGATAAATTTGCCGAGCAGCTGACTAAAGCGCGAG
TAAAACAGTTAGAAAATGAATTTGTTTCGTCATACAAAAAGCTGGCACGTAAAGAAGATGTGCAGCTCAC
CGCTGCCATCAATCCACTCACATTTGATGTTGAGTTAATGGATGAATACGGGATAAAAATCAATCGTAAA
GCCATGTCTGCTGGAGAAAAGCAAATCTACGCTATCTCCATATTGGAAGCGCTTGGCCGCACATCAGGCC
GTAAGCTGCCGATTATTATTGATACGCCGCTTGGTCGCTTAGATTCCCATCATCGTGACAAACTGGTTGA
AAACTATTTTCCTACAGCGAGTCATCAAGTGGTTATTCTATCGACAGATACCGAAATCGACAGAAATTAC
ACCAACCTTATCCAAGACGATATCGCCAGAACTTATGAGATTTGTTTTGATGGAAAAACGAAATCTTCAA
CGATTAAAGAAGGCTACTTCTGGAGAGAAGCCAATAAGGAGGCCGTGTAA