Summary Sequence Context  
1 homologue found:

HomologuedndE
OrganismVibrio cholerae MZO-3
GID1078
PID2078
Locus tagA51_B0784
Locations78149..78496
Length348 bp
G+C%41.3
Link NCBI: gi:118585852   
SequenceATGCTACCTAACCGCATGAACCTCACTCGCACGACTGAAGAGCAGCTTAAAAAGTTGAAGGGTTATACTG
GTATCACTCCAAACATATCGGCACGTATTGCTTTCTTCCGTTCAATAGAAAGTGACTTCCGTTATCAAGG
CCAAGAAGCAAAGTTAGACGGCTCACTTGTGTTGGATAAATACACTTGGCTTGGTGAAACCAGTGATGTC
ACTGAGTTAGTTTTGAAAATGTACTACCCAGAGCTAGACACTAAAGGATACCAGCAAGCATGGGCTGCGC
ATGTTGAAGATGGAATTGCTTCTCTCAGAAACTTTAAAAACATTGAGAAACTATCCAACACATTATAA