Summary Sequence Alignment 16S rRNA Context  
4 homologues found:

HomologuedndB
OrganismEnterobacter sp. 638
GID1024
PID2024
Locus tagEnt638_0472
Locations539380..540465
Length1086 bp
G+C%48
Link NCBI: gi:146309667  
SequenceATGGCTAATGTTGATGCAGACTATTGCTACTCTTTTCCAGCTATACGTGGCATTCAGGCAGGTCGCCCCT
TCTATATTGCCACATGCCCGATGCGTATAATCCCCAAAATATTCAGCTTTGATGAAAATGACGTTCCCCC
TGAACTACGGGCACAGCGTACGCTGAATAAATCACGCATCCCCGAAATGGTGCGTTATCTCCTGGAAAAT
CCAAAGGATTATGTGTTTTCAGCGCTGACAGCATCCATAGCTGTTGATGTCCAGTTTGATGAGTTCCCCG
GTTCCAATAATCTGGGGACGTTATGCGTGCCAATGGATGCGCAAATCCTCATCAATGATGGTCAGCACCG
CCGTAAAGCGATTGAAGACGCTTTAGACGCTCGCCCGGAATTGGGGCAGGATAATATTCCAGTGTTGTTT
TTTGTCGATGAGGGGCTAAAACGCAGCCAGCAAATGTTCGCTGATTTGAATAAATACGCTATTCGTCCCA
GTCCTTCGTTGTCATCGTTGTATGACCACCGTGATGCCAGTTCAAGCCTGGCTCGTTATCTGGCCATGTC
CGTGGAACCATTCGTCGGGATGACTGAGCTGGAGAAATCAGGTATCAGCCAACGGTCAAATAAATTGTTT
ACGTTAAGCAGCATTAAGCAGGCAACTCGCGCTCTGTTAGGAAAAGACCCTAAAGAGGACAACTTTGAAG
AATGCACCCAAATAGTCACCCACTACTGGCAGGCTATTTTTCGCGTAATGCCGGACTGGCAGCTAGCAGC
GAAAAAAGAGGTTTCTCCCGTCCAGTTACGACAGGACTACGTTCACGCTCATGGCATTGGATTACAGGCC
CTTGGGCAGCTGGGATATACCCTATTGACGGATTATCCTGAGCAATGGCCGGAGAAAATCGGTGCACTCA
AAACATTTAACTGGCGCAGAAATAACCCAGACCTGATCAGACGAGCAATGCAGCACGGCAAGCTGAGTAA
AACCAGTACGGCGATTCAATTAACTTGTAATGCGCTAAAAAACGCACTCTCCCTTCCTCTCACTCCTGAA
GAACAGGAGCTTGAAGCTCAAATGGTTGTCTCATGA

HomologuedndC
OrganismEnterobacter sp. 638
GID1042
PID2042
Locus tagEnt638_0471
Locations537749..539383
Length1635 bp
G+C%47
Link NCBI: gi:146309667  
SequenceATGAGTAAATTAGTTCAGGCCTTCGATTTGGCCGAGTACGAAGAATTTATTAATCAGGAACTATTCGCTG
GACGCCCTTTGTCCGAATATATTGCTGAAGTTCAGAGAATTTATTGCGCAGATAAACGCCCATGGGTAAT
TGGCTACAGCGGTGGCAAAGACTCTTCTGCAGTTATTACGCTGGTGTATCTGGCCCTACTGGGCTTGCCC
CCTGAGATGCGTAACAAAGATGTTTTCTTAGTATCATCTGACACTCTGGTAGAAACGCCAGTGGTGGTTG
ACCTGATTAAGAAAACCATGTTGCAGATTGAGGCTGGTGCAAAGCGCAATGGCTTGCCAATCACCCAGCA
TGCGGTGATGCCAAAAACCAATGAAACATTCTGGGTTAATTTGCTGGGAAAAGGTTATCCGGCACCTACC
CGGAGTTTCCGCTGGTGTACTGAACGAATGAAGATCAATCCGGTAAGCGACTTTATCAAAGACAAAGTCA
GTCAGTTTGATGAGGTAATTGTTGTATTGGGTTCGCGAAGTAGCGAAAGCGCTTCTCGTGCTCAAGTGAT
CGCAAAGCACAAAATTGATGGCTCGCGCCTAGCCCGACATACCACGCTGGCTAATGCCTTTATCTATACT
CCTATTGATACTTGGGATGTAGAAGACGTCTGGAAATTGTTACGTGGTGCGTTTCGCTACGCCCCAGATG
ATATTGATGAGTGGGAAAGCCCGTGGGGTGGTAATAATCGCCCACTCTGGACGCTGTATATGGACTCTTC
CGCGCAGGGAGAGTGTCCACTTGTAATCGATGAAAGCACTCCATCTTGCGGAAATTCTCGTTTCGGTTGC
TGGACTTGTACTGTCGTAACAAAAGACAAAGCAATGGAAAGCCTGATTAAGAATGGTGAAGAGTGGATGT
CCCCTTTGCTGAAATATCGCGATCTGCTGGCATTTACTACCGACCCTGTGAATAAAGATACGTTCCGCAA
CTATAAGCGCCGTACCGGTAAAGTGAGTTATCAATATGCCAAAGACGGTGAAGAAGTAAGTGCAGAGCGT
AAGCATGTTCCCGGTCCTTATTGGCTCAAATATCGTCAACAGTGGCTTAAAGATTTGCTGGAAATTGAGC
GGGATATGAATGCTCAAGGCCATACCATTACCTTAATCACGCAGCCGGAGCTACACGCCATTCGCCAGGA
ATGGCTGAAAGATCCTAATGAGCCGGACTGGTACGACACTTTGCCAGGTATTTTTCGCAACGTATACGGA
AAAGATCTGGACTGGGTTATTGACGACCAGTCACGTTTCAATGCTAGCGATGCGGAACTGCTTGAGCAGA
TCGCCCAAGGATTTGAGGTGGTTCCTGAGATGGTGATGAAACTGATTGAGCTTGAGGTTTCTATGGAAGG
ACTCAGCCGCCGTCAGGGTATCTTCGATAAACTTGGCACTATCTTGAAACAAGACTGGGGCAGTCTCGAA
GATATTAAACAGCAACAAGAGACCTTACAAAAACGCAACGACCGAGATATTCATCAGGAAGAAGTCGCAA
AGTTGGAAGCTGAACTACAGATGCTGCAGCGCAGAATTGCCGAAGTGAGCGAGCCGACTCTGCTTACCAG
TGAGGAAAAAGAACGTGTTAATTAA

HomologuedndD
OrganismEnterobacter sp. 638
GID1060
PID2060
Locus tagEnt638_0470
Locations535759..537759
Length2001 bp
G+C%43
Link NCBI: gi:146309667  
SequenceGTGTTAATTAAACAGCTGGTATTGCGTAATTTCCGTGTATTTAATGGTACTCATGTCATTGATTTGGCGC
CGAGAAAGCGCCAGAACGATGATAATTCGCGTCCGATAGTTCTTTTCGGTGGGCTTAACGGAGCAGGAAA
AACATCAATTCTGTCTGCAATCCGCCTGGCATTGTATGGTCGGTTAGCGTTTGGCCCAGCAACTCAACAA
CAAGAGTATGTTGAAGAACTCAGCGCATTAGTTCACAACGGCTCAACTACTGGTGAACGGCCAAGTGAAG
CGTCGATTGAACTTGTTTTCACCTACAACAAAGGCGGGCATGAAGCTGAATTTACCGTTACGCGCTCGTG
GAAAAAAGGGAAAAAGGATCAACTATCCCTCCAACAAGATGGCCAACTTCTTGAAGAGTTGGATTATGAT
CAATGCCAGGGATTTTTGAATGAATTAATTCCGCATGGAATTGCCGATTTGTTCTTCTTTGATGGTGAAA
AAATTGCAGAGCTCGCTGAAGATGACTCTGGAAATATTCTGCGTACAGCCGTACGTCGCTTGTTAGGTTT
AGATCTCATCTCGAAACTTCGTAATGATTTGATGATCTTTGTTAAGCGTCAGCAATCCAGCCAACTCGCA
GGCTCCCAACAACAAAAACTTGCTGAACTTGAAGAACAGGTTAAGCAGTTTGCTTTCCAGACAGAGCAGA
TTTTAGAAAAAGCTGATTTTGCTAAAATGCGAATTGATTTGCTATCAAAAGAAATCAACCGATATGAAGC
ACTTCTGAATGCGCAAGGTGGTGCATTTGCTCAAACAAAAGCACAAGAAAAACAGAAAGTTGATACTCTG
CTAAAAGAAAAAGATCGCCTTGAAAAAGCATTGCGCCATGAATGCGATAGCTCACTACCTTACGCTCTGG
CACCTAAGACTCTAGAGCGTTTGCTTGAGCAAATTAGTGCAGAGATACAAATTAAGCAGGCGGACAGTTT
TGAAAAGGAATTAACTCAATTTCTTACGCAGCTGAAAAATGATATTTCATTCCGCTCAGGAACTACTGGC
AAAATTGCTGCCGAAGCAATTGAAGATAATCTGAAAGATTACCTGGCAGGGAAACCCAAAGGTGAGCTGC
TGTTTGACATCTCAGAACGTGAAGCTGGGATGATCCAACAATCTATCGAGAAGGACAGCAAGAAAGCCTG
GCAGCGTTTTGATCTTTATCGTCACCAATTGGCTGAAGTTGAAGAGCAGCTTGAACAAGCCGCGGCAAAC
ATTGCTCGTGCCCCGGAAGATGATCAGCTTTTCGATATATTTGAAAAACTTCGTGAGCTTGACCGTAAAC
GCGAGAGTAAACGGCAGGAGTATCGCTCGCTGTTGGAAGAAGCAAAACAAACTAAGCAGCTGCAACTGGA
CTGTGCTCGTCAGGTACAAAAAACACACGATCTGGCACGTAATCAACATAACTCCGATAGTGCATTTAAT
AATGCCCAAGAAACAATCAACCTGCTTGACCGCTACAGTGAACTTTTAACTCAAGCAAGGGTGAAAACGC
TATCAGCGAATTTTGAAGGTGCTTACCGTAAATTAGCTCGTAAAGAGGATTTGCAGCTCAATGCACACAT
CAATCCTGAAACGTTTGATGTGGAATTAGTGGATGAAAACGCCTCAGTGATCAATCGCAAGCTACTCTCT
GCCGGAGAGAAACAGATCTATGCGATTGCGATTCTTGAGGCCCTGGCAAAAACTTCTGGTCGTGATTTGC
CGGTAATCATTGATACTCCACTGGGCCGTTTAGACTCTCAACATAGAGATAAACTGATTAACCACTACTT
CCCGTTTGCCAGCCATCAGGTAGTGCTGTTGTCTACAGATACAGAAGTGGATGAGCGTTATTTTGTCGAT
CAACTTCGAGATGACATATCTCATGCTTATGAGATAGTGTTCAATGCACATACGAAATCTTCCGCACTTA
AGCCAGGTTATTTCTGGGAATTAACTAAGGAGGCAATCTGA

HomologuedndE
OrganismEnterobacter sp. 638
GID1079
PID2079
Locus tagEnt638_0469
Locations535406..535744
Length339 bp
G+C%38.3
Link NCBI: gi:146309667  
SequenceATGCAGCTCAGTCGTCAAACTGAAGAAAAACTGAAAAAGTTAAAGGGATATACTGGGATCACACCAAATG
TTGTCGCCCGACTGGCATTTTTTCGCTCGGTAGAAAGTGAGTTTCGATATTCACCAGAACGAGATAGTAA
AAAGTTGGATGGTGTTTTGGTGCTCGACAAAATTACGTGGTTGGGTGAAACACTACAAACTACGGAATTA
GTACTTAAGATGTTATATCCACAGCTAGAGCAGAAAATGTTAATTAAAGCATGGGCGGCACATGTTGAGG
ATGGGGTTGCTGCAATAAGAAATTATAAAAATCTCAAAAGTATAACACAAGCTTTATAA