Summary Sequence Context  
1 homologue found:

HomologuedndB
OrganismEnterobacter sp. 638
GID1024
PID2024
Locus tagEnt638_0472
Locations539380..540465
Length1086 bp
G+C%48
Link NCBI: gi:146309667  
SequenceATGGCTAATGTTGATGCAGACTATTGCTACTCTTTTCCAGCTATACGTGGCATTCAGGCAGGTCGCCCCT
TCTATATTGCCACATGCCCGATGCGTATAATCCCCAAAATATTCAGCTTTGATGAAAATGACGTTCCCCC
TGAACTACGGGCACAGCGTACGCTGAATAAATCACGCATCCCCGAAATGGTGCGTTATCTCCTGGAAAAT
CCAAAGGATTATGTGTTTTCAGCGCTGACAGCATCCATAGCTGTTGATGTCCAGTTTGATGAGTTCCCCG
GTTCCAATAATCTGGGGACGTTATGCGTGCCAATGGATGCGCAAATCCTCATCAATGATGGTCAGCACCG
CCGTAAAGCGATTGAAGACGCTTTAGACGCTCGCCCGGAATTGGGGCAGGATAATATTCCAGTGTTGTTT
TTTGTCGATGAGGGGCTAAAACGCAGCCAGCAAATGTTCGCTGATTTGAATAAATACGCTATTCGTCCCA
GTCCTTCGTTGTCATCGTTGTATGACCACCGTGATGCCAGTTCAAGCCTGGCTCGTTATCTGGCCATGTC
CGTGGAACCATTCGTCGGGATGACTGAGCTGGAGAAATCAGGTATCAGCCAACGGTCAAATAAATTGTTT
ACGTTAAGCAGCATTAAGCAGGCAACTCGCGCTCTGTTAGGAAAAGACCCTAAAGAGGACAACTTTGAAG
AATGCACCCAAATAGTCACCCACTACTGGCAGGCTATTTTTCGCGTAATGCCGGACTGGCAGCTAGCAGC
GAAAAAAGAGGTTTCTCCCGTCCAGTTACGACAGGACTACGTTCACGCTCATGGCATTGGATTACAGGCC
CTTGGGCAGCTGGGATATACCCTATTGACGGATTATCCTGAGCAATGGCCGGAGAAAATCGGTGCACTCA
AAACATTTAACTGGCGCAGAAATAACCCAGACCTGATCAGACGAGCAATGCAGCACGGCAAGCTGAGTAA
AACCAGTACGGCGATTCAATTAACTTGTAATGCGCTAAAAAACGCACTCTCCCTTCCTCTCACTCCTGAA
GAACAGGAGCTTGAAGCTCAAATGGTTGTCTCATGA