Summary Sequence Context  
1 homologue found:

HomologuedndC
OrganismEnterobacter sp. 638
GID1042
PID2042
Locus tagEnt638_0471
Locations537749..539383
Length1635 bp
G+C%47
Link NCBI: gi:146309667  
SequenceATGAGTAAATTAGTTCAGGCCTTCGATTTGGCCGAGTACGAAGAATTTATTAATCAGGAACTATTCGCTG
GACGCCCTTTGTCCGAATATATTGCTGAAGTTCAGAGAATTTATTGCGCAGATAAACGCCCATGGGTAAT
TGGCTACAGCGGTGGCAAAGACTCTTCTGCAGTTATTACGCTGGTGTATCTGGCCCTACTGGGCTTGCCC
CCTGAGATGCGTAACAAAGATGTTTTCTTAGTATCATCTGACACTCTGGTAGAAACGCCAGTGGTGGTTG
ACCTGATTAAGAAAACCATGTTGCAGATTGAGGCTGGTGCAAAGCGCAATGGCTTGCCAATCACCCAGCA
TGCGGTGATGCCAAAAACCAATGAAACATTCTGGGTTAATTTGCTGGGAAAAGGTTATCCGGCACCTACC
CGGAGTTTCCGCTGGTGTACTGAACGAATGAAGATCAATCCGGTAAGCGACTTTATCAAAGACAAAGTCA
GTCAGTTTGATGAGGTAATTGTTGTATTGGGTTCGCGAAGTAGCGAAAGCGCTTCTCGTGCTCAAGTGAT
CGCAAAGCACAAAATTGATGGCTCGCGCCTAGCCCGACATACCACGCTGGCTAATGCCTTTATCTATACT
CCTATTGATACTTGGGATGTAGAAGACGTCTGGAAATTGTTACGTGGTGCGTTTCGCTACGCCCCAGATG
ATATTGATGAGTGGGAAAGCCCGTGGGGTGGTAATAATCGCCCACTCTGGACGCTGTATATGGACTCTTC
CGCGCAGGGAGAGTGTCCACTTGTAATCGATGAAAGCACTCCATCTTGCGGAAATTCTCGTTTCGGTTGC
TGGACTTGTACTGTCGTAACAAAAGACAAAGCAATGGAAAGCCTGATTAAGAATGGTGAAGAGTGGATGT
CCCCTTTGCTGAAATATCGCGATCTGCTGGCATTTACTACCGACCCTGTGAATAAAGATACGTTCCGCAA
CTATAAGCGCCGTACCGGTAAAGTGAGTTATCAATATGCCAAAGACGGTGAAGAAGTAAGTGCAGAGCGT
AAGCATGTTCCCGGTCCTTATTGGCTCAAATATCGTCAACAGTGGCTTAAAGATTTGCTGGAAATTGAGC
GGGATATGAATGCTCAAGGCCATACCATTACCTTAATCACGCAGCCGGAGCTACACGCCATTCGCCAGGA
ATGGCTGAAAGATCCTAATGAGCCGGACTGGTACGACACTTTGCCAGGTATTTTTCGCAACGTATACGGA
AAAGATCTGGACTGGGTTATTGACGACCAGTCACGTTTCAATGCTAGCGATGCGGAACTGCTTGAGCAGA
TCGCCCAAGGATTTGAGGTGGTTCCTGAGATGGTGATGAAACTGATTGAGCTTGAGGTTTCTATGGAAGG
ACTCAGCCGCCGTCAGGGTATCTTCGATAAACTTGGCACTATCTTGAAACAAGACTGGGGCAGTCTCGAA
GATATTAAACAGCAACAAGAGACCTTACAAAAACGCAACGACCGAGATATTCATCAGGAAGAAGTCGCAA
AGTTGGAAGCTGAACTACAGATGCTGCAGCGCAGAATTGCCGAAGTGAGCGAGCCGACTCTGCTTACCAG
TGAGGAAAAAGAACGTGTTAATTAA