Summary Sequence Context  
1 homologue found:

HomologuedndD
OrganismEnterobacter sp. 638
GID1060
PID2060
Locus tagEnt638_0470
Locations535759..537759
Length2001 bp
G+C%43
Link NCBI: gi:146309667  
SequenceGTGTTAATTAAACAGCTGGTATTGCGTAATTTCCGTGTATTTAATGGTACTCATGTCATTGATTTGGCGC
CGAGAAAGCGCCAGAACGATGATAATTCGCGTCCGATAGTTCTTTTCGGTGGGCTTAACGGAGCAGGAAA
AACATCAATTCTGTCTGCAATCCGCCTGGCATTGTATGGTCGGTTAGCGTTTGGCCCAGCAACTCAACAA
CAAGAGTATGTTGAAGAACTCAGCGCATTAGTTCACAACGGCTCAACTACTGGTGAACGGCCAAGTGAAG
CGTCGATTGAACTTGTTTTCACCTACAACAAAGGCGGGCATGAAGCTGAATTTACCGTTACGCGCTCGTG
GAAAAAAGGGAAAAAGGATCAACTATCCCTCCAACAAGATGGCCAACTTCTTGAAGAGTTGGATTATGAT
CAATGCCAGGGATTTTTGAATGAATTAATTCCGCATGGAATTGCCGATTTGTTCTTCTTTGATGGTGAAA
AAATTGCAGAGCTCGCTGAAGATGACTCTGGAAATATTCTGCGTACAGCCGTACGTCGCTTGTTAGGTTT
AGATCTCATCTCGAAACTTCGTAATGATTTGATGATCTTTGTTAAGCGTCAGCAATCCAGCCAACTCGCA
GGCTCCCAACAACAAAAACTTGCTGAACTTGAAGAACAGGTTAAGCAGTTTGCTTTCCAGACAGAGCAGA
TTTTAGAAAAAGCTGATTTTGCTAAAATGCGAATTGATTTGCTATCAAAAGAAATCAACCGATATGAAGC
ACTTCTGAATGCGCAAGGTGGTGCATTTGCTCAAACAAAAGCACAAGAAAAACAGAAAGTTGATACTCTG
CTAAAAGAAAAAGATCGCCTTGAAAAAGCATTGCGCCATGAATGCGATAGCTCACTACCTTACGCTCTGG
CACCTAAGACTCTAGAGCGTTTGCTTGAGCAAATTAGTGCAGAGATACAAATTAAGCAGGCGGACAGTTT
TGAAAAGGAATTAACTCAATTTCTTACGCAGCTGAAAAATGATATTTCATTCCGCTCAGGAACTACTGGC
AAAATTGCTGCCGAAGCAATTGAAGATAATCTGAAAGATTACCTGGCAGGGAAACCCAAAGGTGAGCTGC
TGTTTGACATCTCAGAACGTGAAGCTGGGATGATCCAACAATCTATCGAGAAGGACAGCAAGAAAGCCTG
GCAGCGTTTTGATCTTTATCGTCACCAATTGGCTGAAGTTGAAGAGCAGCTTGAACAAGCCGCGGCAAAC
ATTGCTCGTGCCCCGGAAGATGATCAGCTTTTCGATATATTTGAAAAACTTCGTGAGCTTGACCGTAAAC
GCGAGAGTAAACGGCAGGAGTATCGCTCGCTGTTGGAAGAAGCAAAACAAACTAAGCAGCTGCAACTGGA
CTGTGCTCGTCAGGTACAAAAAACACACGATCTGGCACGTAATCAACATAACTCCGATAGTGCATTTAAT
AATGCCCAAGAAACAATCAACCTGCTTGACCGCTACAGTGAACTTTTAACTCAAGCAAGGGTGAAAACGC
TATCAGCGAATTTTGAAGGTGCTTACCGTAAATTAGCTCGTAAAGAGGATTTGCAGCTCAATGCACACAT
CAATCCTGAAACGTTTGATGTGGAATTAGTGGATGAAAACGCCTCAGTGATCAATCGCAAGCTACTCTCT
GCCGGAGAGAAACAGATCTATGCGATTGCGATTCTTGAGGCCCTGGCAAAAACTTCTGGTCGTGATTTGC
CGGTAATCATTGATACTCCACTGGGCCGTTTAGACTCTCAACATAGAGATAAACTGATTAACCACTACTT
CCCGTTTGCCAGCCATCAGGTAGTGCTGTTGTCTACAGATACAGAAGTGGATGAGCGTTATTTTGTCGAT
CAACTTCGAGATGACATATCTCATGCTTATGAGATAGTGTTCAATGCACATACGAAATCTTCCGCACTTA
AGCCAGGTTATTTCTGGGAATTAACTAAGGAGGCAATCTGA