Summary Sequence Context  
1 homologue found:

HomologuedndE
OrganismEnterobacter sp. 638
GID1079
PID2079
Locus tagEnt638_0469
Locations535406..535744
Length339 bp
G+C%38.3
Link NCBI: gi:146309667  
SequenceATGCAGCTCAGTCGTCAAACTGAAGAAAAACTGAAAAAGTTAAAGGGATATACTGGGATCACACCAAATG
TTGTCGCCCGACTGGCATTTTTTCGCTCGGTAGAAAGTGAGTTTCGATATTCACCAGAACGAGATAGTAA
AAAGTTGGATGGTGTTTTGGTGCTCGACAAAATTACGTGGTTGGGTGAAACACTACAAACTACGGAATTA
GTACTTAAGATGTTATATCCACAGCTAGAGCAGAAAATGTTAATTAAAGCATGGGCGGCACATGTTGAGG
ATGGGGTTGCTGCAATAAGAAATTATAAAAATCTCAAAAGTATAACACAAGCTTTATAA