Summary Sequence Alignment 16S rRNA Context  
4 homologues found:

HomologuedndB
OrganismShewanella pealeana ATCC 700345
GID1025
PID2025
Locus tagSpea_2305
Locations2799563..2800672
Length1110 bp
G+C%42
Link NCBI: gi:157959830  
SequenceATGAAAAGCCCACAAGATGGTTATTGTTTTTCGTTTCCGGCAGTCAGAGGTATTCAAGCAGGAAAGCCTT
TTTATATAGCAACTTGTCCTCTTAGCACTATTCCCAAGATCTTCGTTTTTGACGAAGAAGAAGTGCCACC
AGAGTTGCGTGCCCAGCGAACGTTAAACAAATCACGTATCCCAGAGATGGTACGTTATTTAGTCGAAAAT
CCAAAAGACTACGTTTTTTCAGCGTTAACTGTATCTGTTGCGTCTACAGTGATATTCGAAGAAAGTGATC
ACAACAACACCCCAAATCTAGGTACGTTGAAAGTCCCTATGGACGCACAGATCCTAATTAATGATGGACA
ACATAGACGTGCAGCAATTGAAGCTGCAATCAAAGAGCAACCAGAGATTGCACACGATAATATTGCAGTA
TTGTTTTTTGTCGATGAAGGACTAAAACGCAGCCAACAGATGTTTGCAGACCTAAACAAATATGCAGTTA
AACCAAGCCCTTCTCTGGCAGCGCTTTATGATAGTCGCGATGAAAGCGCCGAGCTTGCAAGGTATCTAGC
GCAAAACGTTAAACCTTTCGAAGGTTTTACTGAGATGGAAAAATCCAGCATAAGCTCAAAAAGCGGAAAG
CTATTTACCTTAAGCAGCCTAAAGCAAGCTAACAGAGCTCTACTAGGTAAAGGTGTTAAAGACAGCTTTA
CTGAAGAAGAGAAACAATTAGCCGCAGACTATTGGCAAGCAGTATTTGCAGAAACACCTGAATGGCAAAT
GGTAATAAATAAAGAATTATCTCCTTCGCAGTTTAGGCAAGAGTATGTGCATGCGCACGGCGTTGGCCTC
CATGCGTTGGGTGCATTAGGTTGCTCATTAATCACAGCGCAACCTGATGTCTGGAAAGAAACAATTAAGC
AGTTAAAAAATGTAGATTGGCGTAAATCCAACCCTGTATGGGCCAACCGCAGCATGTTACATGGCAAGTT
AAGCAAAGCGTCAACCAACATAATGTTGACGACAAATGCACTCAAGCAAAGCTTATCTCTATCATTAACG
CCGGAAGAACGCGCTCTAGAAAATAAACATATACCAAGTAGTGAGGCATCCAATGGCTGA

HomologuedndC
OrganismShewanella pealeana ATCC 700345
GID1043
PID2043
Locus tagSpea_2306
Locations2800665..2802431
Length1767 bp
G+C%42.3
Link NCBI: gi:157959830  
SequenceATGGCTGATTTATTCCAAGCCGATGCGCTAGATGATGAGCAGTTAGAATATATTCAAAATGAATTCTTTG
CTGGTTTCAAGCGATACAAAAACAGCGATACGTTACCAGCAGGTCTCGATAAATACGACAAACTCGATGA
TTCTTTAAAGCATCAAGTTAGTATCAATTTATGTCGAGAACTATTGCGTGAACAAAAGAATAACGAAGGC
TTTCCGTTAAAACACTTTATCGATGATGTTCAAAGTGTTTATTGTTCTGATAACCGCCCTTGGGTAATTG
GCTACAGTGGTGGTAAAGATTCATCAGCCGTTGTCACGCTCATTTACCTAGCTCTGCTATCACTTGATGA
ATCTAAGCGCACCAAGCCAGTATATGTTGTGGCATCAGACACATTGGTAGAAACTCCATTAGTGGTCGAT
CATGTAAATCGTTCACTTGAAAGCATTGGCAATAATGCCAAGAAAGATGGTCTACCGTTAACAACACATA
AAGTATTACCAAAACCGCACCAAACGTTTTGGTCATGTTTACTGGGTAAAGGTTACCCTGCACCAACTCA
AAGTTTCCGTTGGTGTACTGAGCGCATGAAAATCGATCCTGTTAGTGACTTTATTAAAGATAAGGTATCA
CAGCATGACGAAGTGATTGTTATTTTAGGCTCTCGCAGCCAAGAAAGTGCGTCTCGTGCGCAGGTTATCG
CCAAGCATAAAATAGAAAACACACGACTAGCTCGTCACACCACACTAGCCAATGCATTTATCTATACACC
AATTGATACCTGGAGTATGGACGATGTATGGAAGCTAATTCGCGCCTGTAGCTTAGAGGTGACCATTTCA
CCGATGGGTATAGGTAAAAAATGGGCTGATGAATATGGTCTTGAATGGGAAAACCCATGGGGTGGTAAAA
ACCTTACTCTATGGAACCTATATAAAGATTCATCAGACCAAGGCGAATGCCCAATGGTTATCGACGATAG
TACGCCTTCATGCGGTAATTCACGTTTCGGTTGCTGGACATGTACCGTAGTCACAAAAGACCGTGCAATG
GAAAGCTTAATCCAAAACGGTGAAGAATGGATGCAGCCACTGCTAACATTCCGCAACAAGTTGGCTGAAA
CCAATGTGCCGGCAAACAAAGATATCTACCGCAATTACAAACGACGCCAAGGTAAAGTCAATTACCAACG
CGTAAAAGACGGACAAGAATTATCTGAAGAACGCGCACACGTGCCCGGGCCTTATTGGCTTAAATACCGT
AAAGAGTGGTTAACCGAACTGTTAGTGCAACAAAGAGAGTTCAATAAAGATGGCTATTCAGTCACCTTAG
TTACCGAGCCTGAACTACACGCTATTCGCCAAGAATGGTTGAACGACCCGAACGAACCAGACTGGGCTGA
CTCACTACCAAAAATCTATCGCGAAGTATTTGGTGTCGATCTTAATTGGGTAATTAACGACAACTCTAGT
TTCGGTGAAGTTGAAGCGCAGATTCTTACCGATTTAGGCGAGCAATATAACGTTGAGCCTGAAATGGTAC
AAAAGCTTTTGGATCTTGAGCTTTCTTTAGAAGGCCTAAGTCGTCGTACCGGTGTATTCGATAAACTCGG
TACCCTACTAAGGCAAGACTGGGGCACGCTTGATGAAATCAAACAGCGCCACGCTCAACTGCAAAGTAAG
TCAGATTTTGATATCCATAAGGATCAAATCGACAAATATGAACGTGAAATTCTTGAGCTAGAAAAGCAAG
CCAAGGTGGAGTTTTAA

HomologuedndD
OrganismShewanella pealeana ATCC 700345
GID1061
PID2061
Locus tagSpea_2307
Locations2802433..2804463
Length2031 bp
G+C%43
Link NCBI: gi:157959830  
SequenceATGATAATCAAAAGCCTGGTGATCAATAACTTTCGAGTATTTCGTGGCGTACACGAGATTGACTTAGAAC
CAAGAGTAACCCGTAAACACCAAACTGCTGCATCGCCTATCGTGTTATTTGGTGGATTAAATGGTGCAGG
TAAAACCTCTATTTTATCTGCAGTCCGTGTGGCCTTGTACGGCCGCGCAGCATTTGGCCGCGGCATGAAC
TCAGCTCAATATCAAGAGCAACTAGATGCACTGATTCATAATGGTGTAGGGATTAGTGCAGACAAAGCGT
CAATCCAGCTCATCTTTACTCATAGCCAAAATGGTGTTGAAAGCGAATATCGCGTCACTCGTGGTTGGAA
GCGTGGCCAAAAAGATAAATTGGTTTTAGAGCAGAACAACACTGAACTCAGTAGCATGAGTTACGATCAA
TGCCAAAGCTTCCTTAATGAGCTTATCCCGCCGGGGATCTCAGACCTATTCTTCTTCGACGGGGAAAAAA
TTGCCGATCTTGCAGAAGATGAATCCGGTGAAGTACTGCAAACTGCAGTTAGACGCCTTTTAGGTATTGA
TGTTGCCGAGCGTTTGCGTAGTGATTTAGCTATCTATCTAAAACGCCATGATGCCGCAGCAATGCCAGAT
AACATCAAAGCTCAAATTGACAAGTTAGAATCTGATCGCACTGCAGCCGAACATGCCGCTGTAGAGCTAA
CTAACAAAGCATCATTGTGCCGCGCAAAAATCGAACTAATAGCTAAAGATATCGAAAAAACCGAACTTGA
TCTATCTTCACGAGGTGGTGCTTGGGCACAAAGCCGTGAGCAAGAAAAGGCTAAACAGTTTGAACTAGAC
GCTGAACGCAAAGAACTAGAAAAAACACTACGGGCGGAGATTGAAGGTGACCTACCATTTGCATTGGCCC
CCAATGCAATGCAAGCACTACTCACTCAATTAGAAGCCGAAAAGAAAGCTAAGCAAGCTGATAGTTTTAA
CTCTGAGCTAAAGGGCTTCTTAACTGAATTAGAGCAGAAGTTATCATTCTCGCTATCTAACTCCTTTGTC
GCAATAGAAACAATCAAAGAATGTTTAAATGATCGTGAATCACAGCAGGTAAAGACTGATATCCAGCTTG
ATTTAGCAGATAGAGAGTACGATCAAATTAAAGCGCAGATTAACAACCAAGCGCCCTCTTCCTATAAGCG
TTTTGACGAAGCACGTAAACGCTTAGCTATAGTTGAAGAGCAACTAGATTCTATCTCAATTAATATTGCC
CGCGCACCAGAGCAAGAACAACTGGAGACGCAACTTGAAGCGTTAAAAGAGCTTAATAGCCGCCGCACCG
CTGCAATTGTAGAGCATAGAGATACGACTGAAGCGGCGAAACGAAAATACCGTGAAGCAATTGATTACGC
ACGTAAAGTACAAAAGCTGCATGACAAGCATAAAGTCGCCTCTACCGCTGAAGCATCGCTAACAAACGCG
CAAAATACCCATGCATTGTTAGCAGAATTCAGTGAGCAACTAACTGCAGTACGTGTTAAACAACTAGAAG
CTGAGTTTATCAAAAGCTATCAAAAGCTGGCACGTAAAGAAGACCTAAAGCTTTCAGCACGCATCAACAC
TACTACCTTTGACGTTGAGTTAATCGATGAGGATCAGCACACCATTAGCCGTAGAGGCCTGTCTGCCGGT
GAAAAACAGATCTACGCTATTTCAATTCTCGAAGCATTAGGTAAAACATCGGGTAAGAAACTGCCAATCA
TTATCGATACACCGCTAGGTCGACTTGACTCTAAACACAGAGATAAGTTGATTGAGCACTACTTCCCTGA
GGCCAGCCATCAAGTAATCATTCTGTCTACCGATACAGAGATTGATGAAGCGTACTTTGGAGAGGATTAT
CTAAAAGATGACATTTCTCATGCCTTTGAGATTCAGTTTGATGCCGCCACTAAATCATCAAAACTGCGTG
AAGGTTATTTCTGGGAACAGAACTCTGCTAATAATGAAGTGCAACAAAATTCAGTAGTAGGAGCCAACTA
A

HomologuedndE
OrganismShewanella pealeana ATCC 700345
GID1080
PID2080
Locus tagSpea_2308
Locations2804463..2804831
Length369 bp
G+C%42.2
Link NCBI: gi:157959830  
SequenceATGCTACCAAATCGGATGAACCTAACTCGCTCTACTGAAGAGCAATTGAAAAAACTGAAGCAATACACGG
GAATCGCACCCAACGTATCATCACGAATCGCCTTCTTCCGCTCAATAGAGTCAGGTTTTATCTATCGACC
AGCAGATTCTATTGACACTGAAGCAAAACTAGATGGTAGTTTGGTATTAGATAAAGTGACTTGGATGGGG
GAAACGCAGTTGGTGAGTGAACAGCTACTAAAACTTAAGTACCCAACATTAGAAGGTCGCTCTCTCATGT
CTGCATGGGCTGCCCATGTTGAAGATGGGATTGCAGCTGTCCGAAACCACAAAAAAATCAATGAACTTTC
AAATGCTATAGTGACTTAA