Summary Sequence Context  
1 homologue found:

HomologuedndB
OrganismShewanella pealeana ATCC 700345
GID1025
PID2025
Locus tagSpea_2305
Locations2799563..2800672
Length1110 bp
G+C%42
Link NCBI: gi:157959830  
SequenceATGAAAAGCCCACAAGATGGTTATTGTTTTTCGTTTCCGGCAGTCAGAGGTATTCAAGCAGGAAAGCCTT
TTTATATAGCAACTTGTCCTCTTAGCACTATTCCCAAGATCTTCGTTTTTGACGAAGAAGAAGTGCCACC
AGAGTTGCGTGCCCAGCGAACGTTAAACAAATCACGTATCCCAGAGATGGTACGTTATTTAGTCGAAAAT
CCAAAAGACTACGTTTTTTCAGCGTTAACTGTATCTGTTGCGTCTACAGTGATATTCGAAGAAAGTGATC
ACAACAACACCCCAAATCTAGGTACGTTGAAAGTCCCTATGGACGCACAGATCCTAATTAATGATGGACA
ACATAGACGTGCAGCAATTGAAGCTGCAATCAAAGAGCAACCAGAGATTGCACACGATAATATTGCAGTA
TTGTTTTTTGTCGATGAAGGACTAAAACGCAGCCAACAGATGTTTGCAGACCTAAACAAATATGCAGTTA
AACCAAGCCCTTCTCTGGCAGCGCTTTATGATAGTCGCGATGAAAGCGCCGAGCTTGCAAGGTATCTAGC
GCAAAACGTTAAACCTTTCGAAGGTTTTACTGAGATGGAAAAATCCAGCATAAGCTCAAAAAGCGGAAAG
CTATTTACCTTAAGCAGCCTAAAGCAAGCTAACAGAGCTCTACTAGGTAAAGGTGTTAAAGACAGCTTTA
CTGAAGAAGAGAAACAATTAGCCGCAGACTATTGGCAAGCAGTATTTGCAGAAACACCTGAATGGCAAAT
GGTAATAAATAAAGAATTATCTCCTTCGCAGTTTAGGCAAGAGTATGTGCATGCGCACGGCGTTGGCCTC
CATGCGTTGGGTGCATTAGGTTGCTCATTAATCACAGCGCAACCTGATGTCTGGAAAGAAACAATTAAGC
AGTTAAAAAATGTAGATTGGCGTAAATCCAACCCTGTATGGGCCAACCGCAGCATGTTACATGGCAAGTT
AAGCAAAGCGTCAACCAACATAATGTTGACGACAAATGCACTCAAGCAAAGCTTATCTCTATCATTAACG
CCGGAAGAACGCGCTCTAGAAAATAAACATATACCAAGTAGTGAGGCATCCAATGGCTGA