Summary Sequence Context  
1 homologue found:

HomologuedndC
OrganismShewanella pealeana ATCC 700345
GID1043
PID2043
Locus tagSpea_2306
Locations2800665..2802431
Length1767 bp
G+C%42.3
Link NCBI: gi:157959830  
SequenceATGGCTGATTTATTCCAAGCCGATGCGCTAGATGATGAGCAGTTAGAATATATTCAAAATGAATTCTTTG
CTGGTTTCAAGCGATACAAAAACAGCGATACGTTACCAGCAGGTCTCGATAAATACGACAAACTCGATGA
TTCTTTAAAGCATCAAGTTAGTATCAATTTATGTCGAGAACTATTGCGTGAACAAAAGAATAACGAAGGC
TTTCCGTTAAAACACTTTATCGATGATGTTCAAAGTGTTTATTGTTCTGATAACCGCCCTTGGGTAATTG
GCTACAGTGGTGGTAAAGATTCATCAGCCGTTGTCACGCTCATTTACCTAGCTCTGCTATCACTTGATGA
ATCTAAGCGCACCAAGCCAGTATATGTTGTGGCATCAGACACATTGGTAGAAACTCCATTAGTGGTCGAT
CATGTAAATCGTTCACTTGAAAGCATTGGCAATAATGCCAAGAAAGATGGTCTACCGTTAACAACACATA
AAGTATTACCAAAACCGCACCAAACGTTTTGGTCATGTTTACTGGGTAAAGGTTACCCTGCACCAACTCA
AAGTTTCCGTTGGTGTACTGAGCGCATGAAAATCGATCCTGTTAGTGACTTTATTAAAGATAAGGTATCA
CAGCATGACGAAGTGATTGTTATTTTAGGCTCTCGCAGCCAAGAAAGTGCGTCTCGTGCGCAGGTTATCG
CCAAGCATAAAATAGAAAACACACGACTAGCTCGTCACACCACACTAGCCAATGCATTTATCTATACACC
AATTGATACCTGGAGTATGGACGATGTATGGAAGCTAATTCGCGCCTGTAGCTTAGAGGTGACCATTTCA
CCGATGGGTATAGGTAAAAAATGGGCTGATGAATATGGTCTTGAATGGGAAAACCCATGGGGTGGTAAAA
ACCTTACTCTATGGAACCTATATAAAGATTCATCAGACCAAGGCGAATGCCCAATGGTTATCGACGATAG
TACGCCTTCATGCGGTAATTCACGTTTCGGTTGCTGGACATGTACCGTAGTCACAAAAGACCGTGCAATG
GAAAGCTTAATCCAAAACGGTGAAGAATGGATGCAGCCACTGCTAACATTCCGCAACAAGTTGGCTGAAA
CCAATGTGCCGGCAAACAAAGATATCTACCGCAATTACAAACGACGCCAAGGTAAAGTCAATTACCAACG
CGTAAAAGACGGACAAGAATTATCTGAAGAACGCGCACACGTGCCCGGGCCTTATTGGCTTAAATACCGT
AAAGAGTGGTTAACCGAACTGTTAGTGCAACAAAGAGAGTTCAATAAAGATGGCTATTCAGTCACCTTAG
TTACCGAGCCTGAACTACACGCTATTCGCCAAGAATGGTTGAACGACCCGAACGAACCAGACTGGGCTGA
CTCACTACCAAAAATCTATCGCGAAGTATTTGGTGTCGATCTTAATTGGGTAATTAACGACAACTCTAGT
TTCGGTGAAGTTGAAGCGCAGATTCTTACCGATTTAGGCGAGCAATATAACGTTGAGCCTGAAATGGTAC
AAAAGCTTTTGGATCTTGAGCTTTCTTTAGAAGGCCTAAGTCGTCGTACCGGTGTATTCGATAAACTCGG
TACCCTACTAAGGCAAGACTGGGGCACGCTTGATGAAATCAAACAGCGCCACGCTCAACTGCAAAGTAAG
TCAGATTTTGATATCCATAAGGATCAAATCGACAAATATGAACGTGAAATTCTTGAGCTAGAAAAGCAAG
CCAAGGTGGAGTTTTAA