Summary Sequence Context  
1 homologue found:

HomologuedndD
OrganismShewanella pealeana ATCC 700345
GID1061
PID2061
Locus tagSpea_2307
Locations2802433..2804463
Length2031 bp
G+C%43
Link NCBI: gi:157959830  
SequenceATGATAATCAAAAGCCTGGTGATCAATAACTTTCGAGTATTTCGTGGCGTACACGAGATTGACTTAGAAC
CAAGAGTAACCCGTAAACACCAAACTGCTGCATCGCCTATCGTGTTATTTGGTGGATTAAATGGTGCAGG
TAAAACCTCTATTTTATCTGCAGTCCGTGTGGCCTTGTACGGCCGCGCAGCATTTGGCCGCGGCATGAAC
TCAGCTCAATATCAAGAGCAACTAGATGCACTGATTCATAATGGTGTAGGGATTAGTGCAGACAAAGCGT
CAATCCAGCTCATCTTTACTCATAGCCAAAATGGTGTTGAAAGCGAATATCGCGTCACTCGTGGTTGGAA
GCGTGGCCAAAAAGATAAATTGGTTTTAGAGCAGAACAACACTGAACTCAGTAGCATGAGTTACGATCAA
TGCCAAAGCTTCCTTAATGAGCTTATCCCGCCGGGGATCTCAGACCTATTCTTCTTCGACGGGGAAAAAA
TTGCCGATCTTGCAGAAGATGAATCCGGTGAAGTACTGCAAACTGCAGTTAGACGCCTTTTAGGTATTGA
TGTTGCCGAGCGTTTGCGTAGTGATTTAGCTATCTATCTAAAACGCCATGATGCCGCAGCAATGCCAGAT
AACATCAAAGCTCAAATTGACAAGTTAGAATCTGATCGCACTGCAGCCGAACATGCCGCTGTAGAGCTAA
CTAACAAAGCATCATTGTGCCGCGCAAAAATCGAACTAATAGCTAAAGATATCGAAAAAACCGAACTTGA
TCTATCTTCACGAGGTGGTGCTTGGGCACAAAGCCGTGAGCAAGAAAAGGCTAAACAGTTTGAACTAGAC
GCTGAACGCAAAGAACTAGAAAAAACACTACGGGCGGAGATTGAAGGTGACCTACCATTTGCATTGGCCC
CCAATGCAATGCAAGCACTACTCACTCAATTAGAAGCCGAAAAGAAAGCTAAGCAAGCTGATAGTTTTAA
CTCTGAGCTAAAGGGCTTCTTAACTGAATTAGAGCAGAAGTTATCATTCTCGCTATCTAACTCCTTTGTC
GCAATAGAAACAATCAAAGAATGTTTAAATGATCGTGAATCACAGCAGGTAAAGACTGATATCCAGCTTG
ATTTAGCAGATAGAGAGTACGATCAAATTAAAGCGCAGATTAACAACCAAGCGCCCTCTTCCTATAAGCG
TTTTGACGAAGCACGTAAACGCTTAGCTATAGTTGAAGAGCAACTAGATTCTATCTCAATTAATATTGCC
CGCGCACCAGAGCAAGAACAACTGGAGACGCAACTTGAAGCGTTAAAAGAGCTTAATAGCCGCCGCACCG
CTGCAATTGTAGAGCATAGAGATACGACTGAAGCGGCGAAACGAAAATACCGTGAAGCAATTGATTACGC
ACGTAAAGTACAAAAGCTGCATGACAAGCATAAAGTCGCCTCTACCGCTGAAGCATCGCTAACAAACGCG
CAAAATACCCATGCATTGTTAGCAGAATTCAGTGAGCAACTAACTGCAGTACGTGTTAAACAACTAGAAG
CTGAGTTTATCAAAAGCTATCAAAAGCTGGCACGTAAAGAAGACCTAAAGCTTTCAGCACGCATCAACAC
TACTACCTTTGACGTTGAGTTAATCGATGAGGATCAGCACACCATTAGCCGTAGAGGCCTGTCTGCCGGT
GAAAAACAGATCTACGCTATTTCAATTCTCGAAGCATTAGGTAAAACATCGGGTAAGAAACTGCCAATCA
TTATCGATACACCGCTAGGTCGACTTGACTCTAAACACAGAGATAAGTTGATTGAGCACTACTTCCCTGA
GGCCAGCCATCAAGTAATCATTCTGTCTACCGATACAGAGATTGATGAAGCGTACTTTGGAGAGGATTAT
CTAAAAGATGACATTTCTCATGCCTTTGAGATTCAGTTTGATGCCGCCACTAAATCATCAAAACTGCGTG
AAGGTTATTTCTGGGAACAGAACTCTGCTAATAATGAAGTGCAACAAAATTCAGTAGTAGGAGCCAACTA
A