Summary Sequence Context  
1 homologue found:

HomologuedndE
OrganismShewanella pealeana ATCC 700345
GID1080
PID2080
Locus tagSpea_2308
Locations2804463..2804831
Length369 bp
G+C%42.2
Link NCBI: gi:157959830  
SequenceATGCTACCAAATCGGATGAACCTAACTCGCTCTACTGAAGAGCAATTGAAAAAACTGAAGCAATACACGG
GAATCGCACCCAACGTATCATCACGAATCGCCTTCTTCCGCTCAATAGAGTCAGGTTTTATCTATCGACC
AGCAGATTCTATTGACACTGAAGCAAAACTAGATGGTAGTTTGGTATTAGATAAAGTGACTTGGATGGGG
GAAACGCAGTTGGTGAGTGAACAGCTACTAAAACTTAAGTACCCAACATTAGAAGGTCGCTCTCTCATGT
CTGCATGGGCTGCCCATGTTGAAGATGGGATTGCAGCTGTCCGAAACCACAAAAAAATCAATGAACTTTC
AAATGCTATAGTGACTTAA