Summary Sequence Alignment 16S rRNA Context  
5 homologues found:

HomologuedndA
OrganismCandidatus Methanoregula boonei 6A8
GID1009
PID2009
Locus tagMboo_0356
Locations349465..350637
Length1173 bp
G+C%50
Link NCBI: gi:154149549  
SequenceATGGAAAAAATTAACCGTCCAATATACATGGACTCTCACGCCACCACACCGGTGGATCCCCGTGTACTTG
AAGCAATGCTTCCCTATTTTTCCGATATCTTCGGGAATGCTGGCAGCATCGACCATGCATATGGAGCTGT
TGCTGCCGAGGCCGTGAAGAAAGCCCGGGAACAATGTGCCCACCCCTTGAACGCCCATCCCGAGGAAATC
ATTTTCACAAGCGGGGCGACCGAGGCAAATAATATCGCCATCCTTGGGACCGCTGAGCAGTACGCCGAGA
AGGGTGATCACATCATCACCTGTGTTACCGAGCACAAGGCAGTTCTCGATACCTGCAAACATCTCCAGAA
AACTGGGAAGTCTGTGACGTTCTTACCGGTCGATCAATACGGCCTTGTCGATCCGGGTCAGGTTGAAGAT
GCCATCACGGACAAGACTGTTCTGATCTCCATCATGACCGCCAATAACGAGATTGGTACGATTGCTCCCA
TCAAAGAGATTGGAAAGATCGCACACGAGCATGGCGTGATCTTTCACACCGATGCAGCGCAGGCAGTCGG
GCATATTTCGATAGATGTTAAAGAGATGAATATCGATCTCCTCTCATTTTCCGGTCACAAGATCTACGGC
CCCAAAGGGATCGGGGGGTTGTATATCCGGGGCAGCAATCCCCGAGTAAAACTGGCACCAATTGTTTTTG
GCGGTGGGCAGGAGAAAGGGCTCCGGTCAGGTACGCTGAATGTGCCGGGAATTGTTGGGCTCGGAAAGGC
GCTTGCAGTCGCCGAGAAAGAGATGGCAAAAGAGGAGAAGCAATACCGCAAATGGACCACGCAGATGTTC
GATGCGTTCAAAGATGCGTATCCCTCTGTGATGCTGAACGGACATCCCACGAAAAGACTCGCTCACAATC
TGAATGTATGTTTCCCCGGCATTGAGAGCAAGGCGCTGATTCATCTGTTGAAGGATGACGTGTCGATCTC
TGCCGGGTCTGCGTGTACGACAACAAGTGTTGAACCGTCGCATGTGTTGTTGGCAATTGGGCGGACAGAA
GAGGAGTCGCACTGGGCGGTGCGGTTTGGGTTAGGGAGAGGAAATACAGAAGAAATTATTGAATATACGA
TAATCACACTAAAGGACGATTTAAATAAAATAAAAAAAATTTCTGATATTTGA

HomologuedndB
OrganismCandidatus Methanoregula boonei 6A8
GID1026
PID2026
Locus tagMboo_0360
Locations354537..355679
Length1143 bp
G+C%42
Link NCBI: gi:154149549  
SequenceATGAAGGTTGCGGCGTTAGATGAAGTTGATGATCTGGAGACTGCGGTATTTTCTTTTCCTGCAATTCGCG
GCACTCAAGCGGGTAGAGAATATTATTCCGCTATGGTTCAGCTGAAGCTCGTTCCGACAATTTTTCGATT
CAACGAATCGGAAGTTCCAGCACAGGTTAGAGCACAACGCGTTCTGAATCACGCACGGATTCCAGAAATT
GCACACTATATTATAAGCAATCCCCACGACTACGTTTTTTCATCAATTGCAGCGTCAATAAGTGAAGTTC
CGGTAAAATTCGTTCCCGCTCCACAAGATAACCCGAATAGCAGAGTCGGAAAAATTATCATACCCATGGG
CGCGAGGGTTCTCATCAATGATGGGCAACACCGAAGAGCGGCAATCGAATCAGCTCTTAAAGAGCGGCCA
GAGCTTGGCAATGAAACAATATCCGTGGTTTTTTTTATAGATACAGGATTGAAGCGCAGCCAGCAGATGT
TTTCAGATCTGAACCGTCACGCTGTGAGACCGACAAAATCTATAAGCATTCTTTACGATTCACGAGAGGC
ATTCGCTCAATCTGTACGTGATATCGCAACTTCACTTCCAATTTTCAAAGATCTCACCGAATTTGAAAAA
ACATCAATCTCAAACAGATCAAGAAAAATGTTCACGCTCTCTACGATTTATCAAGCGACCGCTGCACTTC
TCGGAAAGAAGACTAAAGTAAAAAAAATAACAAATGATGAGGAAAAACTTGCCTCCAAATATTGGAATAT
AGTGGCTGATAATATTCCCGAGTGGCAACAATTGATCCGAGGAGATGTTGCCAGCAGTTCACTTCGTAAT
GATTTCATTCACGCCCACGGAATCGCTCTTCATGCACTCGGTCTTGCGGGTCATGCCCTCATTGAAGAAT
ATCCTGATACTTGGGAAGAAAAATTGGAAAATCTTCATAAGATTGACTGGTCTCGTTCAAATGCAGAGGT
CTGGGAAGGGCGTGCAATGAATAACGGAACTATATCCAAATCCCAGATGAATCTCGCATTAACCACAAAC
TACCTCAAATATATCTTAACCTTACCTCTTACGAAAGAAGAAGAAAAAAATGAAAAGAAATACCAGACAC
AAGTTCGTGGAAAGTTAAGATGA

HomologuedndC
OrganismCandidatus Methanoregula boonei 6A8
GID1044
PID2044
Locus tagMboo_0359
Locations353077..354540
Length1464 bp
G+C%45
Link NCBI: gi:154149549  
SequenceATGACCTCCAAAAAAACTCCTAACGGAACGACCGATTCAGTATTCGATAAAAAAGGTTTGCAGAACATTT
ATCGCGAGATTCGAGAAGTTTACCTTAGTGACAGCCGCCCGTGGGTTATTGGTTATAGTGGTGGAAAAGA
TTCAACAACTGCTCTTCAACTCGTTTGGTATGCAATTGCAGAATTACCGGAAGAAAAAAGAACAAAACCG
GTATTTGTCATTTCCTCTGACACCCTCGTTGAAACGCCGGTAATTGTGGACTATCTTACAACAACTCTGG
AGCGGATCAATAAGACGGCAGCAGAAAAGAAAATGCCATTCAAGGCATTCAAACTCACCCCTCGCATCAT
TGATTCATTCTGGGTGAATCTTATCGGAAAGGGATATCCAGCGCCAAGCACCCAGTTCCGGTGGTGCACG
GAACGATTGAAGATCCGTACCGCAGACCGGTTCATTCTTGAAAGTGTCACAAAATACGGCGAGGTCGTCA
TGATCCTCGGCGTACGAAAAGGGGAAAGTGCAACCCGTGATCAAGTGATGAACCTGTATAAAATCGAAGG
ATCAAAACTCTCTCATCATTCCCGATTTCCTCAGTCGTATGTGTACACACCGATCGAAGAATTTTCAGTT
GACGATGTCTGGACTTACCTGCTGCAAAAACCATCGCCCTGGGGGAACAACAACCGGGATCTTCTCGCGC
TCTACAAAAGTGCTCAGGATGGGGAATGCCCTCTTGTTGTTGACACTGAAACAGCTTCCTGTGGGAACAG
TCGGTTTGGATGCTGGGTCTGTACAGTCGTGCAGAAAGACCGGAGCATGGAAGCACTTATTGAAAGTGGG
GAAGACTGGATGGAACCCCTTCTTGATTTCCGAAATGAGTTAGCTGAAACCCAGATCCCGGAGAAGAAAC
TCGAATACCGGGATTACCGTCGGATGAATGGAAAAGTAAAATTCATGCAGGCCGGTGATTCCAAAAAAGT
TATTCCTGGTCCCTATACCCTTGAATACTCAAAGATATTACTAAGAAAATTGCTTGAAGCACAGAAGAGT
GTGCGTAAAAATGGTCCCAATCCAAACTTTTCGCTGATCCTATTGGAGGAGCTCCAAGAAATACGTCGTA
TCTGGATGACACAGAAGAGCGATTGGAATGATTCGGTCGTAAAAATCTACGAGGAGGTCACAGGAGAACG
TCTCGACTGGACGAAGGATGATCTCGGCTCATTTTCCCAATCTGAACAGGATCTCTTAAAGAAAATCTGT
GATGATCAAAAATTACCCCTCCGTCTCGTAACAAAACTACTGGATGTAGAGAGGCAGATGCAGGGAATGA
CCCGCCGTTCATCGATTTATAATCGAATCGGTGAGGTGCTGTCTGAAGATTGGATTTCAGAGGACGAAGT
AAAGAAGGCTCTTATAAATCCAAAAGCAGTTGATACAAAACGCCGAAGTCTCCGATATGTGTGA

HomologuedndD
OrganismCandidatus Methanoregula boonei 6A8
GID1062
PID2062
Locus tagMboo_0358
Locations351046..353067
Length2022 bp
G+C%42
Link NCBI: gi:154149549  
SequenceATGTTATTACACTCACTTACACTCGAAAACATCCGAATTTTCAAAGGCAAAAATAGACTAGATTTCACAC
CGATCCTTACTTCGGACGTAAAAAAACCTATCATTCTAATTGGAGGGAAGAACGGTGCCGGGAAAACTAC
TCTCTTCGAATCCATTCTTCTCTGTCTCTACGGTCAGCATGCCCCTGGCAGTTTGATGTCAAAAACAAAA
TATGAGCAGTACATCCGACAGATCGTTCCACGGAGTAAAAAATTAGAAGCCGAGCTTATTCCAGCAATTG
AAATTGTGTTTGAATTTACTCATTCGGGAATACGAAACACCTATGGTGTTCGACGTGAATGGTCACTCGG
GCCAAAATTTTCCGAGAATTTGACAATCACATGCGAAGGAAGTATACTTTCAGAGCTCGAAAAGGACCAA
TGGCAGGATCTTCTCAATGAACTCATCCCCCCCCGGTTTGCTCGACTCTTCCTGTTTGACGGGGAGAAGA
TCCAGAACATCGTAGATGATAATGACGAAAATAATTATCTTCAGGATTCTTTCAAATCATTGCTTGGCCT
TGACATCGTTGACCATCTCAAAGCTGATTTAGGAATTTATTTAAGCCGTCATCTAAGGAGTTCAGATATA
AGTGCGATCAATAAACAGATGAAGGAAACTACTTCTGAAATAGGGAAAATCGAGGAAGAAAAGGAATATT
TGGAACAGGAACGCGCCAAGGTCCAGGGCCAGAGTGAGAGAGTTCAATTGGAAATTGGAAAACAAGAACA
ACTCCTTGCAAGCGAGGGCGGTGGCTTCGCCCGAATACGAGATGATATGAAAGCCGAGAAGGTACGGCTT
GATCAATTTGTGGTAAAAACGGAGAATGAGATAAGTGAATTATGTGAAGGTTTGTTTCCTTTCGCGATAA
CACCAAAATACTGTGAGTCCCTTAAAAAAACTCTGATTGAGGAGGACAAAGTCCAGGCTCATGCGCTTTC
GCAAGAAATAATTCATGCAAATATTGAAGAATTGAACAAAATCATTCAATCCCCCGCCTTTTGGTCGGAT
GTGTCTGTTCCCTCATCCCAGAAAGAAAAAGTACGGGAGAAACTTGTCGATCTAATGTATCAGCACTTGG
TTACTGATGATAGCGTGAAGAAAAAGAAGTTAGTTCATCATCTTTCTCAACACGAATACAAACAACTCCT
GCAATGGATCGAAGAGGCAACGAAGACAACTCCTAAGAAGATGAAAGAGCTATCTGAACAACTTGAGAAA
TTGACTGCACAGCGCCTCAAGATTGCCGAAATGATCAATAAGGCCCCTTCGGATGAGGTGATAGCTCCAC
ATATCACTAAGCTCAATGAATTAAATCAGAAAATTGGCCAATGTTCCGAGCAACTCAGGTCGATTAACGA
ATCAATTCGACAGATTGATCTACGACTAAATGAGCTAAACCGCCAACGGAAAAAATTTGAGGAAGAAATT
CAAGGAGCAAAGGGCGGCTCGATAAAGATGGAACTTGCCCTGCAGGTCACTACAGTTCTAAACGAATACG
CAAAAGAACTCCAGAAACAGAAGATCAATTATCTCGGTGATAATATCCTGTCATGCTTCAACCGCTTGAT
ACGGAAAGACGATTATGTCCAGAAAATTCTGATCGACGAGAATTACAATATTATCTTGTATGATGCCGAC
GGCAACACTATTCCAAAAAATCTACTCTCCGCTGGAGAGAAAGAGATCTTTGCCGTATCTTTGCTTTGGG
GGCTCACCCTTACTTCTGGACGACAACTTCCATTTATCATTGACACTCCACTTGGGAGGCTCGATAGCGA
ACATCGAGGAAATCTTGTAATGGATTTCTTCCAACATGCTGGCGACCAAATGATCATCTTCTCCACGGAT
ACCGAGATTGACAAGGAATATTTCCGGATCCTTCAGCCACAGATTGCCCGGGCATATCATCTCGACTATT
CCAAGAAAGAGCGCCATACATCAATCTCACCGGGCTATTTCTGGCAAGAGGTGGAATCATGA

HomologuedndE
OrganismCandidatus Methanoregula boonei 6A8
GID1085
PID2085
Locus tagMboo_0357
Locations350624..351049
Length426 bp
G+C%46
Link NCBI: gi:154149902  
SequenceATGAGAAGCAGTTTCTATCGTCTCCGGATCAGTGAGAAAGCCACATTCAGGCTCAGCCAGTTGAAAGGAA
AAACCGGACTAACACCGAATATCATCTGTCGAATAGCAATTTGCTATTCACTTAATGATCCCTCGATTCC
CAACCCTGCAGATTACGATGAAAGAGGGCAGGAAATCAACCGTTATTCCCTGACAGGGGAATGGGATACC
TTCTTTATTGCGCTCGTAAAAGAACGATGTATTCACGACAAACTTGACCCGGAAGAAGATCTGTACGATC
AGCTCCGAGCACACCTGAACAGGGGTGTATTCGGGATCTTCCCTCAAATCAAGAGTCTCGGAGATTTCCG
TATCCTTCTGGTACATCAGGCTGCGGGGATCAAATCTGGTATGTTATCCGAGGGGCATTCGCATGGAAAA
AATTAA