Summary Sequence Context  
1 homologue found:

HomologuedndA
OrganismCandidatus Methanoregula boonei 6A8
GID1009
PID2009
Locus tagMboo_0356
Locations349465..350637
Length1173 bp
G+C%50
Link NCBI: gi:154149549  
SequenceATGGAAAAAATTAACCGTCCAATATACATGGACTCTCACGCCACCACACCGGTGGATCCCCGTGTACTTG
AAGCAATGCTTCCCTATTTTTCCGATATCTTCGGGAATGCTGGCAGCATCGACCATGCATATGGAGCTGT
TGCTGCCGAGGCCGTGAAGAAAGCCCGGGAACAATGTGCCCACCCCTTGAACGCCCATCCCGAGGAAATC
ATTTTCACAAGCGGGGCGACCGAGGCAAATAATATCGCCATCCTTGGGACCGCTGAGCAGTACGCCGAGA
AGGGTGATCACATCATCACCTGTGTTACCGAGCACAAGGCAGTTCTCGATACCTGCAAACATCTCCAGAA
AACTGGGAAGTCTGTGACGTTCTTACCGGTCGATCAATACGGCCTTGTCGATCCGGGTCAGGTTGAAGAT
GCCATCACGGACAAGACTGTTCTGATCTCCATCATGACCGCCAATAACGAGATTGGTACGATTGCTCCCA
TCAAAGAGATTGGAAAGATCGCACACGAGCATGGCGTGATCTTTCACACCGATGCAGCGCAGGCAGTCGG
GCATATTTCGATAGATGTTAAAGAGATGAATATCGATCTCCTCTCATTTTCCGGTCACAAGATCTACGGC
CCCAAAGGGATCGGGGGGTTGTATATCCGGGGCAGCAATCCCCGAGTAAAACTGGCACCAATTGTTTTTG
GCGGTGGGCAGGAGAAAGGGCTCCGGTCAGGTACGCTGAATGTGCCGGGAATTGTTGGGCTCGGAAAGGC
GCTTGCAGTCGCCGAGAAAGAGATGGCAAAAGAGGAGAAGCAATACCGCAAATGGACCACGCAGATGTTC
GATGCGTTCAAAGATGCGTATCCCTCTGTGATGCTGAACGGACATCCCACGAAAAGACTCGCTCACAATC
TGAATGTATGTTTCCCCGGCATTGAGAGCAAGGCGCTGATTCATCTGTTGAAGGATGACGTGTCGATCTC
TGCCGGGTCTGCGTGTACGACAACAAGTGTTGAACCGTCGCATGTGTTGTTGGCAATTGGGCGGACAGAA
GAGGAGTCGCACTGGGCGGTGCGGTTTGGGTTAGGGAGAGGAAATACAGAAGAAATTATTGAATATACGA
TAATCACACTAAAGGACGATTTAAATAAAATAAAAAAAATTTCTGATATTTGA