Summary Sequence Context  
1 homologue found:

HomologuedndB
OrganismCandidatus Methanoregula boonei 6A8
GID1026
PID2026
Locus tagMboo_0360
Locations354537..355679
Length1143 bp
G+C%42
Link NCBI: gi:154149549  
SequenceATGAAGGTTGCGGCGTTAGATGAAGTTGATGATCTGGAGACTGCGGTATTTTCTTTTCCTGCAATTCGCG
GCACTCAAGCGGGTAGAGAATATTATTCCGCTATGGTTCAGCTGAAGCTCGTTCCGACAATTTTTCGATT
CAACGAATCGGAAGTTCCAGCACAGGTTAGAGCACAACGCGTTCTGAATCACGCACGGATTCCAGAAATT
GCACACTATATTATAAGCAATCCCCACGACTACGTTTTTTCATCAATTGCAGCGTCAATAAGTGAAGTTC
CGGTAAAATTCGTTCCCGCTCCACAAGATAACCCGAATAGCAGAGTCGGAAAAATTATCATACCCATGGG
CGCGAGGGTTCTCATCAATGATGGGCAACACCGAAGAGCGGCAATCGAATCAGCTCTTAAAGAGCGGCCA
GAGCTTGGCAATGAAACAATATCCGTGGTTTTTTTTATAGATACAGGATTGAAGCGCAGCCAGCAGATGT
TTTCAGATCTGAACCGTCACGCTGTGAGACCGACAAAATCTATAAGCATTCTTTACGATTCACGAGAGGC
ATTCGCTCAATCTGTACGTGATATCGCAACTTCACTTCCAATTTTCAAAGATCTCACCGAATTTGAAAAA
ACATCAATCTCAAACAGATCAAGAAAAATGTTCACGCTCTCTACGATTTATCAAGCGACCGCTGCACTTC
TCGGAAAGAAGACTAAAGTAAAAAAAATAACAAATGATGAGGAAAAACTTGCCTCCAAATATTGGAATAT
AGTGGCTGATAATATTCCCGAGTGGCAACAATTGATCCGAGGAGATGTTGCCAGCAGTTCACTTCGTAAT
GATTTCATTCACGCCCACGGAATCGCTCTTCATGCACTCGGTCTTGCGGGTCATGCCCTCATTGAAGAAT
ATCCTGATACTTGGGAAGAAAAATTGGAAAATCTTCATAAGATTGACTGGTCTCGTTCAAATGCAGAGGT
CTGGGAAGGGCGTGCAATGAATAACGGAACTATATCCAAATCCCAGATGAATCTCGCATTAACCACAAAC
TACCTCAAATATATCTTAACCTTACCTCTTACGAAAGAAGAAGAAAAAAATGAAAAGAAATACCAGACAC
AAGTTCGTGGAAAGTTAAGATGA