Summary Sequence Context  
1 homologue found:

HomologuedndC
OrganismCandidatus Methanoregula boonei 6A8
GID1044
PID2044
Locus tagMboo_0359
Locations353077..354540
Length1464 bp
G+C%45
Link NCBI: gi:154149549  
SequenceATGACCTCCAAAAAAACTCCTAACGGAACGACCGATTCAGTATTCGATAAAAAAGGTTTGCAGAACATTT
ATCGCGAGATTCGAGAAGTTTACCTTAGTGACAGCCGCCCGTGGGTTATTGGTTATAGTGGTGGAAAAGA
TTCAACAACTGCTCTTCAACTCGTTTGGTATGCAATTGCAGAATTACCGGAAGAAAAAAGAACAAAACCG
GTATTTGTCATTTCCTCTGACACCCTCGTTGAAACGCCGGTAATTGTGGACTATCTTACAACAACTCTGG
AGCGGATCAATAAGACGGCAGCAGAAAAGAAAATGCCATTCAAGGCATTCAAACTCACCCCTCGCATCAT
TGATTCATTCTGGGTGAATCTTATCGGAAAGGGATATCCAGCGCCAAGCACCCAGTTCCGGTGGTGCACG
GAACGATTGAAGATCCGTACCGCAGACCGGTTCATTCTTGAAAGTGTCACAAAATACGGCGAGGTCGTCA
TGATCCTCGGCGTACGAAAAGGGGAAAGTGCAACCCGTGATCAAGTGATGAACCTGTATAAAATCGAAGG
ATCAAAACTCTCTCATCATTCCCGATTTCCTCAGTCGTATGTGTACACACCGATCGAAGAATTTTCAGTT
GACGATGTCTGGACTTACCTGCTGCAAAAACCATCGCCCTGGGGGAACAACAACCGGGATCTTCTCGCGC
TCTACAAAAGTGCTCAGGATGGGGAATGCCCTCTTGTTGTTGACACTGAAACAGCTTCCTGTGGGAACAG
TCGGTTTGGATGCTGGGTCTGTACAGTCGTGCAGAAAGACCGGAGCATGGAAGCACTTATTGAAAGTGGG
GAAGACTGGATGGAACCCCTTCTTGATTTCCGAAATGAGTTAGCTGAAACCCAGATCCCGGAGAAGAAAC
TCGAATACCGGGATTACCGTCGGATGAATGGAAAAGTAAAATTCATGCAGGCCGGTGATTCCAAAAAAGT
TATTCCTGGTCCCTATACCCTTGAATACTCAAAGATATTACTAAGAAAATTGCTTGAAGCACAGAAGAGT
GTGCGTAAAAATGGTCCCAATCCAAACTTTTCGCTGATCCTATTGGAGGAGCTCCAAGAAATACGTCGTA
TCTGGATGACACAGAAGAGCGATTGGAATGATTCGGTCGTAAAAATCTACGAGGAGGTCACAGGAGAACG
TCTCGACTGGACGAAGGATGATCTCGGCTCATTTTCCCAATCTGAACAGGATCTCTTAAAGAAAATCTGT
GATGATCAAAAATTACCCCTCCGTCTCGTAACAAAACTACTGGATGTAGAGAGGCAGATGCAGGGAATGA
CCCGCCGTTCATCGATTTATAATCGAATCGGTGAGGTGCTGTCTGAAGATTGGATTTCAGAGGACGAAGT
AAAGAAGGCTCTTATAAATCCAAAAGCAGTTGATACAAAACGCCGAAGTCTCCGATATGTGTGA