Summary Sequence Context  
1 homologue found:

HomologuedndD
OrganismCandidatus Methanoregula boonei 6A8
GID1062
PID2062
Locus tagMboo_0358
Locations351046..353067
Length2022 bp
G+C%42
Link NCBI: gi:154149549  
SequenceATGTTATTACACTCACTTACACTCGAAAACATCCGAATTTTCAAAGGCAAAAATAGACTAGATTTCACAC
CGATCCTTACTTCGGACGTAAAAAAACCTATCATTCTAATTGGAGGGAAGAACGGTGCCGGGAAAACTAC
TCTCTTCGAATCCATTCTTCTCTGTCTCTACGGTCAGCATGCCCCTGGCAGTTTGATGTCAAAAACAAAA
TATGAGCAGTACATCCGACAGATCGTTCCACGGAGTAAAAAATTAGAAGCCGAGCTTATTCCAGCAATTG
AAATTGTGTTTGAATTTACTCATTCGGGAATACGAAACACCTATGGTGTTCGACGTGAATGGTCACTCGG
GCCAAAATTTTCCGAGAATTTGACAATCACATGCGAAGGAAGTATACTTTCAGAGCTCGAAAAGGACCAA
TGGCAGGATCTTCTCAATGAACTCATCCCCCCCCGGTTTGCTCGACTCTTCCTGTTTGACGGGGAGAAGA
TCCAGAACATCGTAGATGATAATGACGAAAATAATTATCTTCAGGATTCTTTCAAATCATTGCTTGGCCT
TGACATCGTTGACCATCTCAAAGCTGATTTAGGAATTTATTTAAGCCGTCATCTAAGGAGTTCAGATATA
AGTGCGATCAATAAACAGATGAAGGAAACTACTTCTGAAATAGGGAAAATCGAGGAAGAAAAGGAATATT
TGGAACAGGAACGCGCCAAGGTCCAGGGCCAGAGTGAGAGAGTTCAATTGGAAATTGGAAAACAAGAACA
ACTCCTTGCAAGCGAGGGCGGTGGCTTCGCCCGAATACGAGATGATATGAAAGCCGAGAAGGTACGGCTT
GATCAATTTGTGGTAAAAACGGAGAATGAGATAAGTGAATTATGTGAAGGTTTGTTTCCTTTCGCGATAA
CACCAAAATACTGTGAGTCCCTTAAAAAAACTCTGATTGAGGAGGACAAAGTCCAGGCTCATGCGCTTTC
GCAAGAAATAATTCATGCAAATATTGAAGAATTGAACAAAATCATTCAATCCCCCGCCTTTTGGTCGGAT
GTGTCTGTTCCCTCATCCCAGAAAGAAAAAGTACGGGAGAAACTTGTCGATCTAATGTATCAGCACTTGG
TTACTGATGATAGCGTGAAGAAAAAGAAGTTAGTTCATCATCTTTCTCAACACGAATACAAACAACTCCT
GCAATGGATCGAAGAGGCAACGAAGACAACTCCTAAGAAGATGAAAGAGCTATCTGAACAACTTGAGAAA
TTGACTGCACAGCGCCTCAAGATTGCCGAAATGATCAATAAGGCCCCTTCGGATGAGGTGATAGCTCCAC
ATATCACTAAGCTCAATGAATTAAATCAGAAAATTGGCCAATGTTCCGAGCAACTCAGGTCGATTAACGA
ATCAATTCGACAGATTGATCTACGACTAAATGAGCTAAACCGCCAACGGAAAAAATTTGAGGAAGAAATT
CAAGGAGCAAAGGGCGGCTCGATAAAGATGGAACTTGCCCTGCAGGTCACTACAGTTCTAAACGAATACG
CAAAAGAACTCCAGAAACAGAAGATCAATTATCTCGGTGATAATATCCTGTCATGCTTCAACCGCTTGAT
ACGGAAAGACGATTATGTCCAGAAAATTCTGATCGACGAGAATTACAATATTATCTTGTATGATGCCGAC
GGCAACACTATTCCAAAAAATCTACTCTCCGCTGGAGAGAAAGAGATCTTTGCCGTATCTTTGCTTTGGG
GGCTCACCCTTACTTCTGGACGACAACTTCCATTTATCATTGACACTCCACTTGGGAGGCTCGATAGCGA
ACATCGAGGAAATCTTGTAATGGATTTCTTCCAACATGCTGGCGACCAAATGATCATCTTCTCCACGGAT
ACCGAGATTGACAAGGAATATTTCCGGATCCTTCAGCCACAGATTGCCCGGGCATATCATCTCGACTATT
CCAAGAAAGAGCGCCATACATCAATCTCACCGGGCTATTTCTGGCAAGAGGTGGAATCATGA