Summary Sequence Context  
1 homologue found:

HomologuedndE
OrganismCandidatus Methanoregula boonei 6A8
GID1085
PID2085
Locus tagMboo_0357
Locations350624..351049
Length426 bp
G+C%46
Link NCBI: gi:154149902  
SequenceATGAGAAGCAGTTTCTATCGTCTCCGGATCAGTGAGAAAGCCACATTCAGGCTCAGCCAGTTGAAAGGAA
AAACCGGACTAACACCGAATATCATCTGTCGAATAGCAATTTGCTATTCACTTAATGATCCCTCGATTCC
CAACCCTGCAGATTACGATGAAAGAGGGCAGGAAATCAACCGTTATTCCCTGACAGGGGAATGGGATACC
TTCTTTATTGCGCTCGTAAAAGAACGATGTATTCACGACAAACTTGACCCGGAAGAAGATCTGTACGATC
AGCTCCGAGCACACCTGAACAGGGGTGTATTCGGGATCTTCCCTCAAATCAAGAGTCTCGGAGATTTCCG
TATCCTTCTGGTACATCAGGCTGCGGGGATCAAATCTGGTATGTTATCCGAGGGGCATTCGCATGGAAAA
AATTAA