Summary Sequence Alignment 16S rRNA Context  
4 homologues found:

HomologuedndB
OrganismBurkholderia ambifaria MC40-6
GID1027
PID2027
Locus tagBamMC406_0012
Locations16182..17309
Length1128 bp
G+C%56
Link NCBI: gi:172059067  
SequenceATGGCAGAGAATTTTTCCTATGTTTTCCCGGCAATACGGGGCGTGCAGGCCGGACGTGAGTACTACGTCT
CGATGTGCCCGCTTCGCCTGTTGCCACGCCTGTTTACATTCGATGAAGAGGAACTGGTGCCAGAGTTGCG
CGCGCAGCGAACACTGAACAAGGCACGGATTCCTGATATCGCAAGATACATCGTCGAAAACAAAGCCAGC
TATACGTTTTCGGCCATCACGGTATCCATTGACGGTTCGATTCAGTTCGAGCCTGTCGGTCCCGAAGGCC
CTGCAAAATTCCGTATGGGGTCATTGACCGTGTCGATGGACGCGAAATTTATTGTCAATGACGGGCAACA
TCGGCGCGCAGCTATTTTGCAAGCGCTGGAGGCAGCACCTGAACTGGGCGAGGAGACCATCGCGGTCGTC
TTCTTCTTGGACCGAGGCCTGGAGCGCTGCCAGCAGATGTTTGCGGATCTGAATCGGTACGCAGTCAAGC
CATCGGCTTCCATCGGTGTTCTCTACGACCATCGCAGCGTGGCGGCGAGTTTGGCGAGGCACATGAGTCT
CACATCTCCGGTGTTCAAAAATTTGATTGAAACCGAGAGATCCTCGCTTTCGCCAAGGTCTCGCAAGTTG
TTCACGCTGAGTGCGATCAATTTCGCTAACACCGAACTTTTGCTTGAAAAGGAGCTGGAGGACTTTGGCA
GCGCGAGCGAGAAATGCCTAGAGTTCTGGGAGTCCGTGGGCGCGCAGATTCCGGAATGGAACTATGTCCG
ACAGGCGAAAATGACTTCCGGAGAGGTGCGGCGTGACTTCATTCACTCGCACGCCATAGTGCTGCAGGCG
CTCGGACGAGCAGGACGCTCGCTGTACCAACTTTCCTCAAGTGAGCGTATGAAACGAATCAAGCGACTGC
GCTCCGTGGACTGGTCGAGACAGAATGTCACCACATGGGAGGGGCGCGCCATGATAGGAGGCGCCATGGC
TAAATCCGGCCAGAACATTACATTGACCTGTAACGAGATTAAGCGCGTACTGGGCCTGGGTCACACGGCC
GAGGAAAATGCAGCCGAAGCTGCGTTGCAGGCCTCTCGCAGCCCGCAACGCGGTGCACACCGTAAGGCGA
AGAAATGA

HomologuedndC
OrganismBurkholderia ambifaria MC40-6
GID1045
PID2045
Locus tagBamMC406_0011
Locations14731..16185
Length1455 bp
G+C%54
Link NCBI: gi:172059067  
SequenceATGAGCATGTCTCCAGAACAAATCGTGGACGAGCTGCGCGAGCTTTACTTGTCCGATGCGATCCCTTGGA
TCGTTGGTTATAGCGGGGGTAAGGACTCGACAGCATCCTTGCAGTTGCTATGGACGGCCATAGCGTCGTT
GCCGAAGGCTCGGCGTACCAAGCCCATCCATGTAATCAGCACAGATACTCTGGTCGAGAATCCGATCATT
GCGGGATGGGTCGAGGTATCGCTGCAGCAGATTAACTTGGCCGCAATTCAACAGGAGTTACCCATTACGG
CGCATCGGCTCACGCCGTCCCTAGAGAACCGTTTCTGGGTCAACTTAATTGGAAAGGGCTATCCGGCGCC
ACGCCCCAAATTCAGGTGGTGCACCGACCGATTAAAGATCAGTGCGTCAACGAAGTTCATTCAAGAGCTC
TCTGAGAACCATGGTGAAGCCATCTTGATCCTTGGGCAACGACGTGGTGAGAGTCAGGCTCGCGACAAGG
TGATGGACCAGTATAAGACGAGCACGCGAGCACGCCTTAGCAAGAATAAGGATCCGCGCCTCTCTCGAGT
CTGGGTTTATCCGCCAATCGAAAGCTGGACGAGCGATGACGTTTGGGAGTATTTGATCACGCACCCGAAT
CCATGGGGCATCAGCAATCAGGAGCTGTTCAGCATCTACCGGGGCGCCACGCCCGATGCTGAGTGTCCTG
TAGTCGTGGACACGTCCTCGCCGAGTTGCGGCGACAGCAGATTTGGCTGCTACGTCTGCACGATGGTTAC
GCAGGACAAGTCCATGCAGGCGATGATCCAGAACGATGAGCAAAAGCAGTGGATGCAACCCATCCTCGAT
TTCCGCAACAATAATCTGGCAGGGGAGGATCGCGCTGTTCGAGACTTCCGCCGCATGAATGGGCGACTGA
CAGTGTTCAGAGATGGGCTGGTGCATGGTCCTTACACGCAGGCACACCGCGCAAAGCTGTTGCGCGAATT
GCTGTTGACACAGCGTGTCGTCCGCGACGCGGACAAGGAGCACGGCACCCAGTTGATCGAGCTAATCTCT
ATGGACGAGCTTGAAGAGATCCGACGACTTTGGGTGGAGGAAAAAGGCGAGATTGAGGATTTGCTTCCCA
CTATCTATGCCGAGGTATTTGGTACTCCATATTTAGGCAGGAATCTTGAGCAATCGCCACTGGATGCATC
GGATCTGAAGCTGCTAGAACTAGCGGCTGATGAGGTCGATCCAGAGGCATCGCAAGAACTGTACAAACTC
ACTCGAAGTTTGCTAGCTGTGCAATTTCGGACGATGGAATCTCACAAGCGCTCCAAGCACCTAGACCGCT
TGGAGGAAGTGCTGCGGCACTACGCCTTCCGTAATGAAAATGAAGCTTTTGAATTCGCAATTTCCAACAT
GTCAGCCACAACGCAGGATGGGGATGACTTGGACGCTACCGCAGTGATTGCATGA

HomologuedndD
OrganismBurkholderia ambifaria MC40-6
GID1063
PID2063
Locus tagBamMC406_0010
Locations12744..14726
Length1983 bp
G+C%56
Link NCBI: gi:118701543  
SequenceATGGCGAAGATAACAATCTCCAGTGTTTCCATCGAGAACTTTGGGCCATTTCGCGAACGGCAAACGCTCG
CTCTCGATGTTGAAGAAACGCGGCCGGTCGTCCTGGTCAAGGCGTTAAACGGAAGCGGCAAAACCACTCT
ACTGACTGCCTTGCAGATTGGCCTTTACGGCTATAAGGCAATCGACGGTATGAAACGCTCGGAATATGAG
CAATTGCTGCTTGGCCTTCAGCGACGGGATGCCCTCGGCAATGCGGTCATCGAGATCGACGTCATTGTCG
AGATCGGTGGACTGCCGCGCCATCTACGACTGAGGCGCGAATGGCAAAAAAAGGGCAGCTACCTAACCGA
AGATCTGTCCGTTTTAGAAGGCGGTAGCCTAAACCAAGATTTTTCCCGGTCGTGGGATGAATTCATTGGT
TCGATCTTGCCCGCAGAACTGGTCCAGTTGTTCCTGTTCGACGGAGAGAGGATCGAAGCTTTGGCCAACC
CTGAGCGCCTGCCTGAACTTCTTAAGAGAGCTACGGAGGTTTTCCTGGGCATCGGCGGAATCGACGCTCT
GGGCAACGACCTCAAGGCCTTGGAGCGGCGCGCAGCGCTCAAGAACAAGACATCTTCTTCGGAATTCGAA
GCGGCTCGATCTCATCTTGAAACGCTGGCAGACCAAGTCAAAGTGCTGGAGCGAGCATTACAAACTCTGA
CCCAAGAAAAAGCGTCGGCTCAGAATGCAGTGGAGCAAGCGCAGTCCACCCTCGACAAGTTCGCGAACAC
TGCACAGCGTCAAGGGCTTGAGGCATACCAACAGGCTGCAGCACTGCGTAATGCCGATGAAACGACTCGT
GCGCGCGTACAAGAAATTCGTGCAAGCTTAGCCGAGGCTATATCGGATCCCGTGCTACCTATTGCATGGT
TGCCGCAACTGTGGGGACGCTACCGCGATGCATGGGAGAACGATCAGCGCGCGCGGCATTCGAAGCTGTT
GGGCCAGGAGTTTAGAAAGCGTGACCAGCGCATCATATCGCGGCTAGCGGCATCGTCTTCCAAGGCAACG
GTTGAAGCGGTTCGCCGGGTGCTCGCGGAGGACCTGCAGCGCCAAGGCAAGCCTCGTTCTGCAAGCAGTT
CCGCGCTGCAGGATGCCTCTCCACGGGACACCGAGCGTCAATTGCAGCATGGGCGTGAAAGGCTGCGGGA
CGAGTTAGAGAAATTGCGGTTGGCTCAGGCCGAGCTGGATCGAACAGAGCTACTTCTCGGCCAGATTCCC
GCCGAAGAACAGATTGGAGAAATGCTTACCGTATTGCAATCACACTCGAAAGCTGCAGCCGCGGCAGAGG
CACATCTGGCGAGCATCACACAACGGCTGAGTGAGACACAGAGTCACCTTGAGCACATTCGTACAAGGAT
GAACGCGGCCCATGACCGCCTCGGTACAAATTTCAAGGATCGATCGCTGGAGTCGAAGAGCCTTGAGGCA
TCGGTCCGAACTCGTAAGACCTTAGCGGTCTTCAAGGATCGGTTGTTGGCCTCCAAGGCACACTGGCTGT
CCGAGATGATCACCTCAGAGTTTCGGGGATTGATGCGCAAGAAGAACCTAATTGCTCGGGTGGTCGTTGA
TCCCGCAACGTATCGCGTCTCTATAGAAGACGCCGATCAGCACGAGCTACCTATGGATCGTCTTTCCGCC
GGGGAGCGGCAGCTGCTGGCCATTGCCGTGCTTAGCGCATTGATCAAGGAGCGCAAGGGTCGCTTCCCCG
TAGTCGTTGACACGCCCCTGGCTCGATTGGATCAACGGCACAGATCTACACTCATCAAGCAATTCTTTGC
CACTGTATCCCACCAAGTTATCGTCTTGTCCACGGACCAGGAGGTGGAAGGCGTGGCCTACGAGGCGCTC
AAACCATTTACCGCAGCCGAATACACCTTGGATTTTGACGATGCGAAAGGCTGCACAGTTATCAATGCGG
CAAGCGTCGAGGAGCTTCTGTGA

HomologuedndE
OrganismBurkholderia ambifaria MC40-6
GID1082
PID2082
Locus tagBamMC406_0009
Locations12361..12747
Length387 bp
G+C%54
Link NCBI: gi:172059067  
SequenceGTGAAGGAACGAATTAAATTGACCGCAGCGGCCCGCAACCAGCTGGTTACTCTCAAGCGTCGCACGGGCA
TTGAACACAATAATGCGATCTGTCGCCACGCTTTGTGTATTTCATTGGCGAACCCCTCGATTCCTCCGTC
TGAGGCCCTCAGCTTCAATGGGGGAATTGAGATGGATTGGCGTACGCTGACTGGCGGAGAGGACGCGCTG
TATCACAACCTGCTCGTCGCCAGGTTACTTTCAGAAGGACGCCGGGTGACGGATGCATCGATCCAAGAGA
TATTCTTGCTTCATGTACATCGCGGCCTGTCCTATCTCGTCAGCCGTCGAGATAGCGACCTGTTGATTGA
AATGGCGAAATCCCTACTCGCCGTGGGTGCGCATTAA