Summary Sequence Context  
1 homologue found:

HomologuedndB
OrganismBurkholderia ambifaria MC40-6
GID1027
PID2027
Locus tagBamMC406_0012
Locations16182..17309
Length1128 bp
G+C%56
Link NCBI: gi:172059067  
SequenceATGGCAGAGAATTTTTCCTATGTTTTCCCGGCAATACGGGGCGTGCAGGCCGGACGTGAGTACTACGTCT
CGATGTGCCCGCTTCGCCTGTTGCCACGCCTGTTTACATTCGATGAAGAGGAACTGGTGCCAGAGTTGCG
CGCGCAGCGAACACTGAACAAGGCACGGATTCCTGATATCGCAAGATACATCGTCGAAAACAAAGCCAGC
TATACGTTTTCGGCCATCACGGTATCCATTGACGGTTCGATTCAGTTCGAGCCTGTCGGTCCCGAAGGCC
CTGCAAAATTCCGTATGGGGTCATTGACCGTGTCGATGGACGCGAAATTTATTGTCAATGACGGGCAACA
TCGGCGCGCAGCTATTTTGCAAGCGCTGGAGGCAGCACCTGAACTGGGCGAGGAGACCATCGCGGTCGTC
TTCTTCTTGGACCGAGGCCTGGAGCGCTGCCAGCAGATGTTTGCGGATCTGAATCGGTACGCAGTCAAGC
CATCGGCTTCCATCGGTGTTCTCTACGACCATCGCAGCGTGGCGGCGAGTTTGGCGAGGCACATGAGTCT
CACATCTCCGGTGTTCAAAAATTTGATTGAAACCGAGAGATCCTCGCTTTCGCCAAGGTCTCGCAAGTTG
TTCACGCTGAGTGCGATCAATTTCGCTAACACCGAACTTTTGCTTGAAAAGGAGCTGGAGGACTTTGGCA
GCGCGAGCGAGAAATGCCTAGAGTTCTGGGAGTCCGTGGGCGCGCAGATTCCGGAATGGAACTATGTCCG
ACAGGCGAAAATGACTTCCGGAGAGGTGCGGCGTGACTTCATTCACTCGCACGCCATAGTGCTGCAGGCG
CTCGGACGAGCAGGACGCTCGCTGTACCAACTTTCCTCAAGTGAGCGTATGAAACGAATCAAGCGACTGC
GCTCCGTGGACTGGTCGAGACAGAATGTCACCACATGGGAGGGGCGCGCCATGATAGGAGGCGCCATGGC
TAAATCCGGCCAGAACATTACATTGACCTGTAACGAGATTAAGCGCGTACTGGGCCTGGGTCACACGGCC
GAGGAAAATGCAGCCGAAGCTGCGTTGCAGGCCTCTCGCAGCCCGCAACGCGGTGCACACCGTAAGGCGA
AGAAATGA