Summary Sequence Context  
1 homologue found:

HomologuedndC
OrganismBurkholderia ambifaria MC40-6
GID1045
PID2045
Locus tagBamMC406_0011
Locations14731..16185
Length1455 bp
G+C%54
Link NCBI: gi:172059067  
SequenceATGAGCATGTCTCCAGAACAAATCGTGGACGAGCTGCGCGAGCTTTACTTGTCCGATGCGATCCCTTGGA
TCGTTGGTTATAGCGGGGGTAAGGACTCGACAGCATCCTTGCAGTTGCTATGGACGGCCATAGCGTCGTT
GCCGAAGGCTCGGCGTACCAAGCCCATCCATGTAATCAGCACAGATACTCTGGTCGAGAATCCGATCATT
GCGGGATGGGTCGAGGTATCGCTGCAGCAGATTAACTTGGCCGCAATTCAACAGGAGTTACCCATTACGG
CGCATCGGCTCACGCCGTCCCTAGAGAACCGTTTCTGGGTCAACTTAATTGGAAAGGGCTATCCGGCGCC
ACGCCCCAAATTCAGGTGGTGCACCGACCGATTAAAGATCAGTGCGTCAACGAAGTTCATTCAAGAGCTC
TCTGAGAACCATGGTGAAGCCATCTTGATCCTTGGGCAACGACGTGGTGAGAGTCAGGCTCGCGACAAGG
TGATGGACCAGTATAAGACGAGCACGCGAGCACGCCTTAGCAAGAATAAGGATCCGCGCCTCTCTCGAGT
CTGGGTTTATCCGCCAATCGAAAGCTGGACGAGCGATGACGTTTGGGAGTATTTGATCACGCACCCGAAT
CCATGGGGCATCAGCAATCAGGAGCTGTTCAGCATCTACCGGGGCGCCACGCCCGATGCTGAGTGTCCTG
TAGTCGTGGACACGTCCTCGCCGAGTTGCGGCGACAGCAGATTTGGCTGCTACGTCTGCACGATGGTTAC
GCAGGACAAGTCCATGCAGGCGATGATCCAGAACGATGAGCAAAAGCAGTGGATGCAACCCATCCTCGAT
TTCCGCAACAATAATCTGGCAGGGGAGGATCGCGCTGTTCGAGACTTCCGCCGCATGAATGGGCGACTGA
CAGTGTTCAGAGATGGGCTGGTGCATGGTCCTTACACGCAGGCACACCGCGCAAAGCTGTTGCGCGAATT
GCTGTTGACACAGCGTGTCGTCCGCGACGCGGACAAGGAGCACGGCACCCAGTTGATCGAGCTAATCTCT
ATGGACGAGCTTGAAGAGATCCGACGACTTTGGGTGGAGGAAAAAGGCGAGATTGAGGATTTGCTTCCCA
CTATCTATGCCGAGGTATTTGGTACTCCATATTTAGGCAGGAATCTTGAGCAATCGCCACTGGATGCATC
GGATCTGAAGCTGCTAGAACTAGCGGCTGATGAGGTCGATCCAGAGGCATCGCAAGAACTGTACAAACTC
ACTCGAAGTTTGCTAGCTGTGCAATTTCGGACGATGGAATCTCACAAGCGCTCCAAGCACCTAGACCGCT
TGGAGGAAGTGCTGCGGCACTACGCCTTCCGTAATGAAAATGAAGCTTTTGAATTCGCAATTTCCAACAT
GTCAGCCACAACGCAGGATGGGGATGACTTGGACGCTACCGCAGTGATTGCATGA