Summary Sequence Context  
1 homologue found:

HomologuedndD
OrganismBurkholderia ambifaria MC40-6
GID1063
PID2063
Locus tagBamMC406_0010
Locations12744..14726
Length1983 bp
G+C%56
Link NCBI: gi:118701543  
SequenceATGGCGAAGATAACAATCTCCAGTGTTTCCATCGAGAACTTTGGGCCATTTCGCGAACGGCAAACGCTCG
CTCTCGATGTTGAAGAAACGCGGCCGGTCGTCCTGGTCAAGGCGTTAAACGGAAGCGGCAAAACCACTCT
ACTGACTGCCTTGCAGATTGGCCTTTACGGCTATAAGGCAATCGACGGTATGAAACGCTCGGAATATGAG
CAATTGCTGCTTGGCCTTCAGCGACGGGATGCCCTCGGCAATGCGGTCATCGAGATCGACGTCATTGTCG
AGATCGGTGGACTGCCGCGCCATCTACGACTGAGGCGCGAATGGCAAAAAAAGGGCAGCTACCTAACCGA
AGATCTGTCCGTTTTAGAAGGCGGTAGCCTAAACCAAGATTTTTCCCGGTCGTGGGATGAATTCATTGGT
TCGATCTTGCCCGCAGAACTGGTCCAGTTGTTCCTGTTCGACGGAGAGAGGATCGAAGCTTTGGCCAACC
CTGAGCGCCTGCCTGAACTTCTTAAGAGAGCTACGGAGGTTTTCCTGGGCATCGGCGGAATCGACGCTCT
GGGCAACGACCTCAAGGCCTTGGAGCGGCGCGCAGCGCTCAAGAACAAGACATCTTCTTCGGAATTCGAA
GCGGCTCGATCTCATCTTGAAACGCTGGCAGACCAAGTCAAAGTGCTGGAGCGAGCATTACAAACTCTGA
CCCAAGAAAAAGCGTCGGCTCAGAATGCAGTGGAGCAAGCGCAGTCCACCCTCGACAAGTTCGCGAACAC
TGCACAGCGTCAAGGGCTTGAGGCATACCAACAGGCTGCAGCACTGCGTAATGCCGATGAAACGACTCGT
GCGCGCGTACAAGAAATTCGTGCAAGCTTAGCCGAGGCTATATCGGATCCCGTGCTACCTATTGCATGGT
TGCCGCAACTGTGGGGACGCTACCGCGATGCATGGGAGAACGATCAGCGCGCGCGGCATTCGAAGCTGTT
GGGCCAGGAGTTTAGAAAGCGTGACCAGCGCATCATATCGCGGCTAGCGGCATCGTCTTCCAAGGCAACG
GTTGAAGCGGTTCGCCGGGTGCTCGCGGAGGACCTGCAGCGCCAAGGCAAGCCTCGTTCTGCAAGCAGTT
CCGCGCTGCAGGATGCCTCTCCACGGGACACCGAGCGTCAATTGCAGCATGGGCGTGAAAGGCTGCGGGA
CGAGTTAGAGAAATTGCGGTTGGCTCAGGCCGAGCTGGATCGAACAGAGCTACTTCTCGGCCAGATTCCC
GCCGAAGAACAGATTGGAGAAATGCTTACCGTATTGCAATCACACTCGAAAGCTGCAGCCGCGGCAGAGG
CACATCTGGCGAGCATCACACAACGGCTGAGTGAGACACAGAGTCACCTTGAGCACATTCGTACAAGGAT
GAACGCGGCCCATGACCGCCTCGGTACAAATTTCAAGGATCGATCGCTGGAGTCGAAGAGCCTTGAGGCA
TCGGTCCGAACTCGTAAGACCTTAGCGGTCTTCAAGGATCGGTTGTTGGCCTCCAAGGCACACTGGCTGT
CCGAGATGATCACCTCAGAGTTTCGGGGATTGATGCGCAAGAAGAACCTAATTGCTCGGGTGGTCGTTGA
TCCCGCAACGTATCGCGTCTCTATAGAAGACGCCGATCAGCACGAGCTACCTATGGATCGTCTTTCCGCC
GGGGAGCGGCAGCTGCTGGCCATTGCCGTGCTTAGCGCATTGATCAAGGAGCGCAAGGGTCGCTTCCCCG
TAGTCGTTGACACGCCCCTGGCTCGATTGGATCAACGGCACAGATCTACACTCATCAAGCAATTCTTTGC
CACTGTATCCCACCAAGTTATCGTCTTGTCCACGGACCAGGAGGTGGAAGGCGTGGCCTACGAGGCGCTC
AAACCATTTACCGCAGCCGAATACACCTTGGATTTTGACGATGCGAAAGGCTGCACAGTTATCAATGCGG
CAAGCGTCGAGGAGCTTCTGTGA