Summary Sequence Context  
1 homologue found:

HomologuedndE
OrganismBurkholderia ambifaria MC40-6
GID1082
PID2082
Locus tagBamMC406_0009
Locations12361..12747
Length387 bp
G+C%54
Link NCBI: gi:172059067  
SequenceGTGAAGGAACGAATTAAATTGACCGCAGCGGCCCGCAACCAGCTGGTTACTCTCAAGCGTCGCACGGGCA
TTGAACACAATAATGCGATCTGTCGCCACGCTTTGTGTATTTCATTGGCGAACCCCTCGATTCCTCCGTC
TGAGGCCCTCAGCTTCAATGGGGGAATTGAGATGGATTGGCGTACGCTGACTGGCGGAGAGGACGCGCTG
TATCACAACCTGCTCGTCGCCAGGTTACTTTCAGAAGGACGCCGGGTGACGGATGCATCGATCCAAGAGA
TATTCTTGCTTCATGTACATCGCGGCCTGTCCTATCTCGTCAGCCGTCGAGATAGCGACCTGTTGATTGA
AATGGCGAAATCCCTACTCGCCGTGGGTGCGCATTAA