Summary Sequence Alignment 16S rRNA Context  
4 homologues found:

HomologuedndC
OrganismSalmonella enterica serovar Saintpaul SARA23
GID1075
PID2075
Locus tagSentent_010100006025
Locations109998..111632
Length1635 bp
G+C%48.2
Link NCBI: gi:149106997  
SequenceATGGCTAGTGTTGATGCAGACTACTGCTACTCGTTTCCGGCTATACGTGGCATTCAGGCAGGTCGCCCTT
TCTATATTGCCACATGCCCGATGCGCATCATACCCAAAATATTCAGCTTTGATGAAAATGACGTCCCTCC
TGAGCTACGAGCACAACGCACGCTGAATAAATCACGCATCCCCGAAATGGTGCGTTATCTGCTGGAAAAT
CCAAAAGATTATGTGTTTTCAGCACTGACAGCGTCTATTGCCGTTGACGTTCAGTTTGATGAGTTCCCTA
ACTCCAACAACCTGGGGACGTTATGCGTGCCAATGGATGCACAAATTCTGATCAACGACGGTCAGCATCG
CCGTAAAGCGATTGAAGACGCTTTGGATGCTCGCCCGGAGCTGGGCCAGGATAATATTCCGGTGTTGTTC
TTTGTTGATGAAGGCTTAAAACGTAGCCAGCAGATGTTCGCCGATCTGAATAAATACGCCATTCGCCCCA
GCCCGTCGCTGGCGTCTCTATACGATCATCGCGATGCCAGTTCAAATCTGGCACGTTATCTGGCGATGTC
CATAGAGCCGTTTGTTGGGATGACAGAACTGGAAAAATCAGGCATCAGTCAGCGGTCGAATAAGTTATTT
ACGTTGAGCAGCATCAAGCAGGCTACCCGCGCATTGTTGGGTAAAGATCCCAAAGAGAACAACTTTGAGG
AATGCACCCAAATAGCTACCCAATATTGGCAAGCTATTTTTAACGTGATGCCGGATTGGCAGCTAGCGGC
TAAAAAAGAGGTTTCACCGGTTCAGTTACGACAAGATTATGTTCACGCTCATGGCATCGGATTGCAGGCA
CTTGGGCAACTGGGATATACCCTGCTAAAGGATTATCCTGAGCAATGGCCGGAGAAAATAGCTGCACTTA
AAACTTTTAACTGGCGCAGAAACAACCCGGATCTCATCAAACGTGCGATGCAGCACGGCAAACTGAGTAA
AACCAATACGGCGATCCAGCTCACCTGTAATGCGCTAAAAACCGCGCTCTCAATTCCCCTCACTCCTGAA
GAACAGGAACTTGAAGCTCAAATGGTTGCCTCATGA

HomologuedndD
OrganismSalmonella enterica serovar Saintpaul SARA23
GID1076
PID2076
Locus tagSentent_010100006020
Locations107999..110014
Length2016 bp
G+C%46.9
Link NCBI: gi:149106997  
SequenceATGAACGTGCTCATTAAGCAACTGGTATTACATAATTTTCGCGTATTTTGCGGCACACACACCATCGATC
TGGCTCCCAGAAAGCGCCCGCATGAAGTCAACCCTCGCCCGATAGTGCTATTTGGTGGTTTAAATGGTGC
AGGGAAAACATCTATTTTGTCGGCAATTCGGCTGGCACTGTATGGGCGTTTAGCGTTTGGCCCGGCAATG
CAGCAACAGGAGTATGTTGAACAACTCGGGGCACTGGTGCACAACGGGACGTATACAGCAGAGCGCCCGG
ATGAGGCCGCAGTAGAACTGACCTTTACCTACAACCAAAACGGCCATGAGACTGAATTCACCGTCACGCG
TAGCTGGAAGAAAGGAAAGAAAGATCGTCTCTCTTTGCAGCAGGATGGACAACCGCGTAGTGAACTCAGT
TATGACCAGTGCCAGGGATTTTTGAATGAATTAATTCCTCACGGTGTCGCCGATCTTTTCTTTTTTGATG
GAGAGAAGATTGCAGAGCTAGCGGAAGATGAATCCGGCAATATTCTGCGTACAGCGGTGCGTCGTTTGTT
GGGACTGGATCTGATCGCCAGACTGCAAAATGATCTGATGATTTTTGTCAAACGCCAGCAAACTGCCCAG
TTGGGTGGCTCCCAGCAACAGCAGGTTGAAGCGCTTGAGGCAAAGATTAAAACGCTTGCCGGTCAGGCGG
AGAAATTGTTGGAAGAAGCCGATTTCGTCAACTCGCGGATCGAATTTTTATCCCAGGACATTATTCGCCA
TGAGGGATTGTTAAATGCGCAGGGCGGCGCATTTGCCCAGACCAAAGCACAGGAAAAACAGAAAGTTGAA
ACGCTGTTAAAAGAAAAAGAGCGTCTGGAAAAAGCGTTACGACAGGAATGCGATGGATCGTTGCCCTATG
CATTAGCGCCTAATACGTTGTCGCGGTTGCTGGAAAAAATTGCCAATGAAGCGCAGATCAAGCAGGCGAA
AATTTTTGAGACAGAGTTAAATCAATTTTTAACTCAACTCAAAAATGATATCGCGTTCCGTTCCAGCAGT
GAGAGTAGTACCAGAGCCATTGCTACCGAAGCGATTACCAATAATTTGGACGCATATATGGCAACCAAAC
CAAAAGGTGATTTGCTGTTTGATATTTCTGAACGTGAAGCCGGTATGCTCCAGCAATCCATTGAGCAGGA
CAGCAAAAAAGCATGGCAGCGTTTTGATATGTACCGCCATCAATTAGCGGATATTGAACAACAACTGGAG
CAGGCCGCTGCCAATATTGCTCGCGCCCCGGAAGACGAGCAGTTAATGGATCTCTTTGCAGCATTACGCG
ATCTCGATCATAAGCGTGAAAAACAGCGGCAAAAATACCGCTCTCTGCTGGAAGAGGCTAAACGGACGAA
ACAGCAGCAACTGGATTGTGTTCGTCAGGTACAGAAAGCACATGACATCACCCGTAGCCAGCATGGTTTG
AGCAGCGCATTTAAAAATGCACAAGAGACCATTAACCTGCTCGATTACTACAGCAATGTACTAACGCAGG
CGCGAGTGAAAAAGTTATCTGCTAACTTTGAAATTGCCTACCACAAGCTGGCCCGTAAAGAGGATTTACA
GCTTAATGCGCACATAAATCCACAGACATTTGATGTTGAACTGGTGGATGAAAAGGGGTCGGTGATTAAT
CGTAAGCTGCTTTCTGCGGGTGAAAAGCAGATTTATGCGATTGCCATTCTTGAGGCGCTAGCAAAAACTT
CTGGGCGTGATTTCCCGGTGATTATTGATACGCCGTTAGGGCGTCTGGATTCTCAGCATCGGGATAAGTT
GATTAATCATTATTTCCCGGAGGCCAGCCATCAGGTTGTGCTGCTATCCACCGATACTGAAGTGGACGAG
CGTTATTTTGTTGATCGGCTGCGTGATGATATTTCTCATGCTTATGAAATTGTGTTTAATGCACATACCA
AATCATCTGCGCTGAAACCTGGCTATTTCTGGGAATTAACCAAGGAGGCTGTCTGA

HomologuedndB
OrganismSalmonella enterica serovar Saintpaul SARA23
GID1077
PID2077
Locus tagSentent_010100006030
Locations111629..112714
Length1086 bp
G+C%48.2
Link NCBI: gi:149106997  
SequenceATGGCTAGTGTTGATGCAGACTACTGCTACTCGTTTCCGGCTATACGTGGCATTCAGGCAGGTCGCCCTT
TCTATATTGCCACATGCCCGATGCGCATCATACCCAAAATATTCAGCTTTGATGAAAATGACGTCCCTCC
TGAGCTACGAGCACAACGCACGCTGAATAAATCACGCATCCCCGAAATGGTGCGTTATCTGCTGGAAAAT
CCAAAAGATTATGTGTTTTCAGCACTGACAGCGTCTATTGCCGTTGACGTTCAGTTTGATGAGTTCCCTA
ACTCCAACAACCTGGGGACGTTATGCGTGCCAATGGATGCACAAATTCTGATCAACGACGGTCAGCATCG
CCGTAAAGCGATTGAAGACGCTTTGGATGCTCGCCCGGAGCTGGGCCAGGATAATATTCCGGTGTTGTTC
TTTGTTGATGAAGGCTTAAAACGTAGCCAGCAGATGTTCGCCGATCTGAATAAATACGCCATTCGCCCCA
GCCCGTCGCTGGCGTCTCTATACGATCATCGCGATGCCAGTTCAAATCTGGCACGTTATCTGGCGATGTC
CATAGAGCCGTTTGTTGGGATGACAGAACTGGAAAAATCAGGCATCAGTCAGCGGTCGAATAAGTTATTT
ACGTTGAGCAGCATCAAGCAGGCTACCCGCGCATTGTTGGGTAAAGATCCCAAAGAGAACAACTTTGAGG
AATGCACCCAAATAGCTACCCAATATTGGCAAGCTATTTTTAACGTGATGCCGGATTGGCAGCTAGCGGC
TAAAAAAGAGGTTTCACCGGTTCAGTTACGACAAGATTATGTTCACGCTCATGGCATCGGATTGCAGGCA
CTTGGGCAACTGGGATATACCCTGCTAAAGGATTATCCTGAGCAATGGCCGGAGAAAATAGCTGCACTTA
AAACTTTTAACTGGCGCAGAAACAACCCGGATCTCATCAAACGTGCGATGCAGCACGGCAAACTGAGTAA
AACCAATACGGCGATCCAGCTCACCTGTAATGCGCTAAAAACCGCGCTCTCAATTCCCCTCACTCCTGAA
GAACAGGAACTTGAAGCTCAAATGGTTGCCTCATGA

HomologuedndE
OrganismSalmonella enterica serovar Saintpaul SARA23
GID1083
PID2083
Locus tagSentent_010100006015
Locations107646..107999
Length354 bp
G+C%45.1
Link NCBI: gi:149106997  
SequenceATGCTCCCGAATCGAATGGTACTTAGCCGTCAGACTGAAGACCAGCTTAAAAAGCTAAAAGGATATACGG
GGATTACACCCAATGTCGCGGCTCGGCTGGCATTTTTCCGCTCAGTGGAGAGTGAGTTTCGCTATTCGCC
TGAGCGGGATAGTAAGAAGCTGGATGGCTCTCTGGTGCTGGATAAAATAACGTGGCTGGGGGAAACGCTG
CAAGCTACGGAGCTGGTACTAAAGATGCTATATCCGCAGCTAGAGCAGAAAATACTAATTAAAGCATGGG
CAGCACATGTTGATGATGGAATTGCTGCATTAAGGAATTATCGAAGCTTAAAAGATTTTTCAAAGAATAT
ATAG