Summary Sequence Context  
1 homologue found:

HomologuedndB
OrganismSalmonella enterica serovar Saintpaul SARA23
GID1077
PID2077
Locus tagSentent_010100006030
Locations111629..112714
Length1086 bp
G+C%48.2
Link NCBI: gi:149106997  
SequenceATGGCTAGTGTTGATGCAGACTACTGCTACTCGTTTCCGGCTATACGTGGCATTCAGGCAGGTCGCCCTT
TCTATATTGCCACATGCCCGATGCGCATCATACCCAAAATATTCAGCTTTGATGAAAATGACGTCCCTCC
TGAGCTACGAGCACAACGCACGCTGAATAAATCACGCATCCCCGAAATGGTGCGTTATCTGCTGGAAAAT
CCAAAAGATTATGTGTTTTCAGCACTGACAGCGTCTATTGCCGTTGACGTTCAGTTTGATGAGTTCCCTA
ACTCCAACAACCTGGGGACGTTATGCGTGCCAATGGATGCACAAATTCTGATCAACGACGGTCAGCATCG
CCGTAAAGCGATTGAAGACGCTTTGGATGCTCGCCCGGAGCTGGGCCAGGATAATATTCCGGTGTTGTTC
TTTGTTGATGAAGGCTTAAAACGTAGCCAGCAGATGTTCGCCGATCTGAATAAATACGCCATTCGCCCCA
GCCCGTCGCTGGCGTCTCTATACGATCATCGCGATGCCAGTTCAAATCTGGCACGTTATCTGGCGATGTC
CATAGAGCCGTTTGTTGGGATGACAGAACTGGAAAAATCAGGCATCAGTCAGCGGTCGAATAAGTTATTT
ACGTTGAGCAGCATCAAGCAGGCTACCCGCGCATTGTTGGGTAAAGATCCCAAAGAGAACAACTTTGAGG
AATGCACCCAAATAGCTACCCAATATTGGCAAGCTATTTTTAACGTGATGCCGGATTGGCAGCTAGCGGC
TAAAAAAGAGGTTTCACCGGTTCAGTTACGACAAGATTATGTTCACGCTCATGGCATCGGATTGCAGGCA
CTTGGGCAACTGGGATATACCCTGCTAAAGGATTATCCTGAGCAATGGCCGGAGAAAATAGCTGCACTTA
AAACTTTTAACTGGCGCAGAAACAACCCGGATCTCATCAAACGTGCGATGCAGCACGGCAAACTGAGTAA
AACCAATACGGCGATCCAGCTCACCTGTAATGCGCTAAAAACCGCGCTCTCAATTCCCCTCACTCCTGAA
GAACAGGAACTTGAAGCTCAAATGGTTGCCTCATGA