Summary Sequence Context  
1 homologue found:

HomologuedndC
OrganismSalmonella enterica serovar Saintpaul SARA23
GID1075
PID2075
Locus tagSentent_010100006025
Locations109998..111632
Length1635 bp
G+C%48.2
Link NCBI: gi:149106997  
SequenceATGGCTAGTGTTGATGCAGACTACTGCTACTCGTTTCCGGCTATACGTGGCATTCAGGCAGGTCGCCCTT
TCTATATTGCCACATGCCCGATGCGCATCATACCCAAAATATTCAGCTTTGATGAAAATGACGTCCCTCC
TGAGCTACGAGCACAACGCACGCTGAATAAATCACGCATCCCCGAAATGGTGCGTTATCTGCTGGAAAAT
CCAAAAGATTATGTGTTTTCAGCACTGACAGCGTCTATTGCCGTTGACGTTCAGTTTGATGAGTTCCCTA
ACTCCAACAACCTGGGGACGTTATGCGTGCCAATGGATGCACAAATTCTGATCAACGACGGTCAGCATCG
CCGTAAAGCGATTGAAGACGCTTTGGATGCTCGCCCGGAGCTGGGCCAGGATAATATTCCGGTGTTGTTC
TTTGTTGATGAAGGCTTAAAACGTAGCCAGCAGATGTTCGCCGATCTGAATAAATACGCCATTCGCCCCA
GCCCGTCGCTGGCGTCTCTATACGATCATCGCGATGCCAGTTCAAATCTGGCACGTTATCTGGCGATGTC
CATAGAGCCGTTTGTTGGGATGACAGAACTGGAAAAATCAGGCATCAGTCAGCGGTCGAATAAGTTATTT
ACGTTGAGCAGCATCAAGCAGGCTACCCGCGCATTGTTGGGTAAAGATCCCAAAGAGAACAACTTTGAGG
AATGCACCCAAATAGCTACCCAATATTGGCAAGCTATTTTTAACGTGATGCCGGATTGGCAGCTAGCGGC
TAAAAAAGAGGTTTCACCGGTTCAGTTACGACAAGATTATGTTCACGCTCATGGCATCGGATTGCAGGCA
CTTGGGCAACTGGGATATACCCTGCTAAAGGATTATCCTGAGCAATGGCCGGAGAAAATAGCTGCACTTA
AAACTTTTAACTGGCGCAGAAACAACCCGGATCTCATCAAACGTGCGATGCAGCACGGCAAACTGAGTAA
AACCAATACGGCGATCCAGCTCACCTGTAATGCGCTAAAAACCGCGCTCTCAATTCCCCTCACTCCTGAA
GAACAGGAACTTGAAGCTCAAATGGTTGCCTCATGA