Summary Sequence Context  
1 homologue found:

HomologuedndD
OrganismSalmonella enterica serovar Saintpaul SARA23
GID1076
PID2076
Locus tagSentent_010100006020
Locations107999..110014
Length2016 bp
G+C%46.9
Link NCBI: gi:149106997  
SequenceATGAACGTGCTCATTAAGCAACTGGTATTACATAATTTTCGCGTATTTTGCGGCACACACACCATCGATC
TGGCTCCCAGAAAGCGCCCGCATGAAGTCAACCCTCGCCCGATAGTGCTATTTGGTGGTTTAAATGGTGC
AGGGAAAACATCTATTTTGTCGGCAATTCGGCTGGCACTGTATGGGCGTTTAGCGTTTGGCCCGGCAATG
CAGCAACAGGAGTATGTTGAACAACTCGGGGCACTGGTGCACAACGGGACGTATACAGCAGAGCGCCCGG
ATGAGGCCGCAGTAGAACTGACCTTTACCTACAACCAAAACGGCCATGAGACTGAATTCACCGTCACGCG
TAGCTGGAAGAAAGGAAAGAAAGATCGTCTCTCTTTGCAGCAGGATGGACAACCGCGTAGTGAACTCAGT
TATGACCAGTGCCAGGGATTTTTGAATGAATTAATTCCTCACGGTGTCGCCGATCTTTTCTTTTTTGATG
GAGAGAAGATTGCAGAGCTAGCGGAAGATGAATCCGGCAATATTCTGCGTACAGCGGTGCGTCGTTTGTT
GGGACTGGATCTGATCGCCAGACTGCAAAATGATCTGATGATTTTTGTCAAACGCCAGCAAACTGCCCAG
TTGGGTGGCTCCCAGCAACAGCAGGTTGAAGCGCTTGAGGCAAAGATTAAAACGCTTGCCGGTCAGGCGG
AGAAATTGTTGGAAGAAGCCGATTTCGTCAACTCGCGGATCGAATTTTTATCCCAGGACATTATTCGCCA
TGAGGGATTGTTAAATGCGCAGGGCGGCGCATTTGCCCAGACCAAAGCACAGGAAAAACAGAAAGTTGAA
ACGCTGTTAAAAGAAAAAGAGCGTCTGGAAAAAGCGTTACGACAGGAATGCGATGGATCGTTGCCCTATG
CATTAGCGCCTAATACGTTGTCGCGGTTGCTGGAAAAAATTGCCAATGAAGCGCAGATCAAGCAGGCGAA
AATTTTTGAGACAGAGTTAAATCAATTTTTAACTCAACTCAAAAATGATATCGCGTTCCGTTCCAGCAGT
GAGAGTAGTACCAGAGCCATTGCTACCGAAGCGATTACCAATAATTTGGACGCATATATGGCAACCAAAC
CAAAAGGTGATTTGCTGTTTGATATTTCTGAACGTGAAGCCGGTATGCTCCAGCAATCCATTGAGCAGGA
CAGCAAAAAAGCATGGCAGCGTTTTGATATGTACCGCCATCAATTAGCGGATATTGAACAACAACTGGAG
CAGGCCGCTGCCAATATTGCTCGCGCCCCGGAAGACGAGCAGTTAATGGATCTCTTTGCAGCATTACGCG
ATCTCGATCATAAGCGTGAAAAACAGCGGCAAAAATACCGCTCTCTGCTGGAAGAGGCTAAACGGACGAA
ACAGCAGCAACTGGATTGTGTTCGTCAGGTACAGAAAGCACATGACATCACCCGTAGCCAGCATGGTTTG
AGCAGCGCATTTAAAAATGCACAAGAGACCATTAACCTGCTCGATTACTACAGCAATGTACTAACGCAGG
CGCGAGTGAAAAAGTTATCTGCTAACTTTGAAATTGCCTACCACAAGCTGGCCCGTAAAGAGGATTTACA
GCTTAATGCGCACATAAATCCACAGACATTTGATGTTGAACTGGTGGATGAAAAGGGGTCGGTGATTAAT
CGTAAGCTGCTTTCTGCGGGTGAAAAGCAGATTTATGCGATTGCCATTCTTGAGGCGCTAGCAAAAACTT
CTGGGCGTGATTTCCCGGTGATTATTGATACGCCGTTAGGGCGTCTGGATTCTCAGCATCGGGATAAGTT
GATTAATCATTATTTCCCGGAGGCCAGCCATCAGGTTGTGCTGCTATCCACCGATACTGAAGTGGACGAG
CGTTATTTTGTTGATCGGCTGCGTGATGATATTTCTCATGCTTATGAAATTGTGTTTAATGCACATACCA
AATCATCTGCGCTGAAACCTGGCTATTTCTGGGAATTAACCAAGGAGGCTGTCTGA