Summary Sequence Context  
1 homologue found:

HomologuedndE
OrganismSalmonella enterica serovar Saintpaul SARA23
GID1083
PID2083
Locus tagSentent_010100006015
Locations107646..107999
Length354 bp
G+C%45.1
Link NCBI: gi:149106997  
SequenceATGCTCCCGAATCGAATGGTACTTAGCCGTCAGACTGAAGACCAGCTTAAAAAGCTAAAAGGATATACGG
GGATTACACCCAATGTCGCGGCTCGGCTGGCATTTTTCCGCTCAGTGGAGAGTGAGTTTCGCTATTCGCC
TGAGCGGGATAGTAAGAAGCTGGATGGCTCTCTGGTGCTGGATAAAATAACGTGGCTGGGGGAAACGCTG
CAAGCTACGGAGCTGGTACTAAAGATGCTATATCCGCAGCTAGAGCAGAAAATACTAATTAAAGCATGGG
CAGCACATGTTGATGATGGAATTGCTGCATTAAGGAATTATCGAAGCTTAAAAGATTTTTCAAAGAATAT
ATAG