Summary Sequence Alignment 16S rRNA Context  
4 homologues found:

HomologuedndB
OrganismVibrio fischeri MJ11
GID1086
PID2086
Locus tagVFMJ11_A0171
Locations194312..195391
Length1080 bp
G+C%38.3
Link NCBI: gi:197336667  
SequenceATGAACAATCACGAATCTGGTTATTGCTATTCATTTCCTGCGGTTAAAGGCATACAAGCAGGTAGACCAT
TCTACATAGCGACCTGCCCTCTACGTATTATTCCAAAGATTTTCAGTTATAACGAAGATGATGTACCACC
CGAGCTACGTGCTCAACGTACTCTAAATAAAACTAGAATCCCTGAAATGGTACGTTACCTTCTTGAAAAT
CCTACAGAATATGTATTCTCTGCTTTAACCGCTTCTGTAGGTGTAGATATCTCATTTAACGAGCATGAAG
GCGCACCTAATCTAGGTATTCTTCATATTCCTATGGATGCACAGATCTTAATCAATGACGGTCAACACAG
ACGTAAAGCGATAGAAGAAGCATTAAGAGAAAACCCAGATCTTGGACAAGATAACATTGCAGTACTCTTC
TTTATTGATGAAGGCTTAGATCGTAGTCAACAAATGTTCGCCGATCTAAATAAATATGCCGTAAAACCAA
GTCCATCACTGGGCACCTTGTATGACCATCGTGATGAAAGCTCAGAACTTGCTCGATTATTAGCGAGTTC
AGTTCAACCATTTATTGGTTTAACTGAAATGGAAAAATCAAATATTTCGCCAAAATCGAATAAGTTATTC
ACGTTAAGTAGTATCAAACAATCCACTCGCGCTCTTTTAAGTAAAGGGGCAAAAGACGGTTTTAACGATG
AAGAAAAAGCATTAGCTTCTGAGTATTGGCAAGAAGTAACAAAACACATCAAAGATTGGCAACTTGTTCT
AAAAAAAGAAGTATCTCCAGCTCAACTACGTCAAGAGTTCATTCATGCTCACGGCCTTGGGCTCCACGCT
TTAGGCTTACTAGGTAAACATTTACTTTGCCAAGAGCCAAATAATTGGAAAGAAAAGCTTTCTTTATTAT
CTGAAGTAGATTGGAGAAAAACGAATAAAGACTGGTTGCAGCGTAGTATGAACCACGGCAAGTTGAGTAA
ATCAACAACCAACATTCAGCTAACTACAAACGCATTAAAAATGAAGCTAGGGTTAACGCTAACTCCTGAA
GAACAAACGCTAGAGAAGCAATTATCATGA

HomologuedndC
OrganismVibrio fischeri MJ11
GID1087
PID2087
Locus tagVFMJ11_A0170
Locations192681..194315
Length1635 bp
G+C%41.4
Link NCBI: gi:197336667  
SequenceATGATACATGACCTCCAACTAACGGAAGACCTTGCAGAAGAATATCAAGAGTTTATTAACACTGAAGACT
TCGCAAATCACAAATTAAGCCACTATGTAGCAGATGTTCAACGTGTTTATTGTGCAGATAATAGACCTTG
GGTGATCGGTTACAGTGGAGGTAAAGACTCCTCTGCTATCATGTCACTTGTTTATCTTGCTCTTCTTGGA
CTAAAAGAAGAAGACCGAACAAAACAAGTGTTTGTTGTTACTTCAGATACCCTAGTCGAAACGCCTGTTG
TGGTAAATCATATCAACGATTCACTCGCCGCTATTCAAACTGGTGCAAAACGTGATGGGTTACCTATTAC
TTGTCACAAGGTAGTACCTGAAGATGATCAAACATTTTGGTCAAGCTTACTCGGTAAAGGCTATCCTGCA
CCTACTCGTTCTTTCCGTTGGTGTACTGAAAGAATGAAAATTAATCCTGTTAGTGACTTCATTAAATCTA
AAGTTTCTCAATTTGATGAGGTTATTGTTGTACTTGGCTCTCGCAGTCAAGAGAGTGCTTCTCGTGCACA
AGTTATTGCTAAGCACAAAATTGACGGCTCACGTTTAGCTCGTCATACAACGCTAGCGAATGCCTTCATT
TTTACACCAATTGATACTTGGGGTGTCGATGACGTTTGGAAAATCTTACGTTTATGCCACTTAGTCACCA
AAGAAACACCTTATGGCACCAAAAACATTTGGAGCAATGACTACGATTTAGAATGGGAAAACCCATGGGG
TGGTAAAAACTTAACACTCTGGAATCTATATAAAGATTCATCAGGTCAGGGCGAATGTCCAATGGTAATT
GATGAAACAACACCTTCTTGTGGTAATTCTCGTTTTGGTTGTTGGACTTGTACCGTTGTTACGCGTGACC
GTGCAATGGAGAGTCTTATTCAAAATGGTGAAGAATGGATGGCTCCTCTTCTGGAGTTCCGAAATAAGTT
AGCAATGACAACGGATCCAGCGAACAAGGAAGAATACCGAAACCACAAACGTCGAACCGGTAAAGTAAGC
TACCAATACGCCAAAGAAGGTGAAGATATAGCTAGCGAGCGAAAGCACGTACCGGGCCCTTACTGGCTTA
AATACCGTCGCCAATGGCTTCGTGAACTTCTAGAACTAGATAAGAAGTTTAAAGCTGAAGGCCGAGAGAT
TGAGCTAATCACGGTGCCAGAGCTACATGCTATTCGTCAAGAATGGATCAAAGATCCAAATGAACCAGAC
TGGGATGACTCTCTACCGACCCTTTTCAAAGACGTTTATGGCTATGACCTAGATTGGGTATACGACGATA
ACGCGAGTTTTGGTAAAGATGACGCTCAGTTAATTCATGAGCTTTGTGACAACTTCGATGTTGAGCCCGA
GATGATCATGAAACTGATCGAGCTGGAAGTTTCTATGGAAGGCTTAAGCCGCCGTAGCGGTATTTCAAAC
AAAATTGCATCGCTATTGAAGCGAGACTGGGGAAGCTTGGAAGATATTAAACAAAAACATGCTTCCCTAC
AGAGTAAGGCTGAGTTTGATATTCACCAAAAAGAAATTGAGCGTTATAACGAACAACTTGCTGACTTAGA
TAAGCAGCTTCAAAAAGAGTTTTAA

HomologuedndD
OrganismVibrio fischeri MJ11
GID1088
PID2088
Locus tagVFMJ11_A0169
Locations190660..192624
Length1965 bp
G+C%41.4
Link NCBI: gi:197336667  
SequenceGTGCATGAAATCGACCTGCGCCCTGCTCCTGCTCGTCTAAGTAAAAATGGTCCAATTGAAGGAACCGAAC
GACCAATCATTCTGTTTGGTGGTCTTAACGGTGCTGGTAAAACATCGATTCTGACAGCAGTACGATTCGC
TCTTTTTGGCCGTCAATCATTTAGCCAAGTACTATCAAATGGCGAGTACGTGGATGCCCTATCCGAGCTT
ATTCATAAAGGTGTCGGCCATGGCGGCGTTCAAGATAACGCATCGATCGAACTTGAGTTTAAATACAGCC
AAAACGGTGAAGAGAACACTTATAAAGTGATTCGCGGTTGGAAGCGCGGTAAGAAAGATAACCTGTACCT
TGAGAAAGATGGTATTCAAATTCCTGAGTTGAATTACGAGCAGTGCCAAGGTTTTCTTAATGAGCTTATT
CCAACGGGTATTGCTGATCTGTTCTTCTTCGACGGCGAGAAAATCGCTGAGCTAGCAGAAGATGAATCTG
GTAGCGTTCTTAAAACAGCTGTGCGTCGTCTACTTGGTTTAGATGTAATCGCGAAACTAAAAAGCGACCT
CAACATTTTCTTAAAGAAACAAGGAGCAGGAGCTTTAAGTCAGTCTTTAAAAGAAGAAATGGATAATCTC
GAGAACATTCGAATTAAACATGAAAGAGAAGCTGACAAGCTCCGATTTGAAGCCGAGAACGAAGTATATA
AGCAGATTATTCATACTAGTTCCGACATCCAAATTTTGGAGAACAAGCTTTCACAGAATGGTGGAGCTTG
GGCAAAAACCAGAGAAGATGAGCAACACAAAGTTGAAAACTTGCTTAAAGAGAAAGTCGAGCTTGAGAAA
CAGATTCGTATGGAAATGGAAACGAACCTTCCATTTTCACTTGCTCCGAAAGCAATGCAAAGGCTTCAAA
CTCAGATCAAACAAGAGCAACAAGTTAAGAAAAAGCAGAACTTTGGTAATGAGCTAGATGCTTTCCTAGA
AACTCTATGCTCAAAATACCCAAGCTTTGATACCGAGATGGCGCAAAACGCAATTGCAGATAGCTTTAAA
GAACACGTAGGTGAATTCGATTCAACAGAGCTTCTTTTGGATATCTCTGATCGCCAAGCGAATACCATCG
ATTACCAATTATCTAACCTATCGCAAGATTCTTTCTCTCGTTTCGACAAAGCACGAGTACGCCTCAGCAA
AGTCGAAGAAGAGATCGACAACGCTTCAAACAATATCGCGCGAGCACCAGAGCAGGAGCAAGTGCAGGAG
TTGTTTGCAGATGTCCGCGCTTTAGATAAGAAAAAAGAAAAGCTGATTATCGAATATCATGACTTGCTGG
AAAAGGCTAAGCAAGAACTTCGACTAGCTTTAGAAACAGCACGCAAAATTCAGAAGCTGCACGATAAAAA
CAAAGATCAATCGAGTAAAGATCAAAGCGTTAGCAATGCTCAAAACTCTATCTTATTACTAGAGAAGTTT
GGAGAGCAGTTAACTAAAGCGCGTGTTAATCAGTTAGAAAATGAATTCGTTCAATCATACAAAAAATTAG
CGCGTAAGGAAGATTTACAACTAACAGCTTCAATCAACCCAGCAACATTCGATGTTGAGTTAGTTGATGA
ACATGGTATTAAAATCAACCGTAAGGCGATGTCTGCTGGTGAGAAGCAGATCTACGCGATCTCGATTCTA
GAGGCTCTTGGCCGTACATCTGGTCGTAAACTTCCAATCATCATTGACACACCACTAGGTCGATTGGATT
CACATCACCGTGACAAACTGGTTGAGAACTATTTCCCAACCGCAAGCCACCAAGTTGTGATTTTATCGAC
TGATACAGAAATCGATAGAAATTATACAAACCTCATCCAAGACGATATTGCTCGCACTTACGAGATCTGT
TTCGACGGTACAACTAAGGCTTCAACGTTGAAAGAAGGTTACTTCTGGAAAGAATCGATTAAGGAGGCCA
TGTAA

HomologuedndE
OrganismVibrio fischeri MJ11
GID1089
PID2089
Locus tagVFMJ11_A0168
Locations190313..190660
Length348 bp
G+C%42.5
Link NCBI: gi:197336667  
SequenceATGCTACCTAACCGCATGAACTTGACTCGCTCTACAGAAGAGCAACTTAAGAAGTTGAAGGGCTATACTG
GAATCACTCCAAACGTATCGGCTCGTATCGCTTTCTTCCGCTCAATTGAAAGTGACTTTCGATACCAAGG
CCAAGAAGCTAAGTTGGACGGCTCACTTGTACTAGATAAGTACACGTGGCTTGGTGAAACTAGTGATGTG
ACTGAACTAATGTTGAAGATGTACTACCCAGAGTTTGATACCAAAGAGTATCAACAAGCTTGGGCAGCAC
ATGTTGAAGATGGGATTGCTGCACTAAGAAACCATAAGAATCTGTTAGGCTTATCAATCAACCTATAA