Summary Sequence Context  
1 homologue found:

HomologuedndB
OrganismVibrio fischeri MJ11
GID1086
PID2086
Locus tagVFMJ11_A0171
Locations194312..195391
Length1080 bp
G+C%38.3
Link NCBI: gi:197336667  
SequenceATGAACAATCACGAATCTGGTTATTGCTATTCATTTCCTGCGGTTAAAGGCATACAAGCAGGTAGACCAT
TCTACATAGCGACCTGCCCTCTACGTATTATTCCAAAGATTTTCAGTTATAACGAAGATGATGTACCACC
CGAGCTACGTGCTCAACGTACTCTAAATAAAACTAGAATCCCTGAAATGGTACGTTACCTTCTTGAAAAT
CCTACAGAATATGTATTCTCTGCTTTAACCGCTTCTGTAGGTGTAGATATCTCATTTAACGAGCATGAAG
GCGCACCTAATCTAGGTATTCTTCATATTCCTATGGATGCACAGATCTTAATCAATGACGGTCAACACAG
ACGTAAAGCGATAGAAGAAGCATTAAGAGAAAACCCAGATCTTGGACAAGATAACATTGCAGTACTCTTC
TTTATTGATGAAGGCTTAGATCGTAGTCAACAAATGTTCGCCGATCTAAATAAATATGCCGTAAAACCAA
GTCCATCACTGGGCACCTTGTATGACCATCGTGATGAAAGCTCAGAACTTGCTCGATTATTAGCGAGTTC
AGTTCAACCATTTATTGGTTTAACTGAAATGGAAAAATCAAATATTTCGCCAAAATCGAATAAGTTATTC
ACGTTAAGTAGTATCAAACAATCCACTCGCGCTCTTTTAAGTAAAGGGGCAAAAGACGGTTTTAACGATG
AAGAAAAAGCATTAGCTTCTGAGTATTGGCAAGAAGTAACAAAACACATCAAAGATTGGCAACTTGTTCT
AAAAAAAGAAGTATCTCCAGCTCAACTACGTCAAGAGTTCATTCATGCTCACGGCCTTGGGCTCCACGCT
TTAGGCTTACTAGGTAAACATTTACTTTGCCAAGAGCCAAATAATTGGAAAGAAAAGCTTTCTTTATTAT
CTGAAGTAGATTGGAGAAAAACGAATAAAGACTGGTTGCAGCGTAGTATGAACCACGGCAAGTTGAGTAA
ATCAACAACCAACATTCAGCTAACTACAAACGCATTAAAAATGAAGCTAGGGTTAACGCTAACTCCTGAA
GAACAAACGCTAGAGAAGCAATTATCATGA