Summary Sequence Context  
1 homologue found:

HomologuedndC
OrganismVibrio fischeri MJ11
GID1087
PID2087
Locus tagVFMJ11_A0170
Locations192681..194315
Length1635 bp
G+C%41.4
Link NCBI: gi:197336667  
SequenceATGATACATGACCTCCAACTAACGGAAGACCTTGCAGAAGAATATCAAGAGTTTATTAACACTGAAGACT
TCGCAAATCACAAATTAAGCCACTATGTAGCAGATGTTCAACGTGTTTATTGTGCAGATAATAGACCTTG
GGTGATCGGTTACAGTGGAGGTAAAGACTCCTCTGCTATCATGTCACTTGTTTATCTTGCTCTTCTTGGA
CTAAAAGAAGAAGACCGAACAAAACAAGTGTTTGTTGTTACTTCAGATACCCTAGTCGAAACGCCTGTTG
TGGTAAATCATATCAACGATTCACTCGCCGCTATTCAAACTGGTGCAAAACGTGATGGGTTACCTATTAC
TTGTCACAAGGTAGTACCTGAAGATGATCAAACATTTTGGTCAAGCTTACTCGGTAAAGGCTATCCTGCA
CCTACTCGTTCTTTCCGTTGGTGTACTGAAAGAATGAAAATTAATCCTGTTAGTGACTTCATTAAATCTA
AAGTTTCTCAATTTGATGAGGTTATTGTTGTACTTGGCTCTCGCAGTCAAGAGAGTGCTTCTCGTGCACA
AGTTATTGCTAAGCACAAAATTGACGGCTCACGTTTAGCTCGTCATACAACGCTAGCGAATGCCTTCATT
TTTACACCAATTGATACTTGGGGTGTCGATGACGTTTGGAAAATCTTACGTTTATGCCACTTAGTCACCA
AAGAAACACCTTATGGCACCAAAAACATTTGGAGCAATGACTACGATTTAGAATGGGAAAACCCATGGGG
TGGTAAAAACTTAACACTCTGGAATCTATATAAAGATTCATCAGGTCAGGGCGAATGTCCAATGGTAATT
GATGAAACAACACCTTCTTGTGGTAATTCTCGTTTTGGTTGTTGGACTTGTACCGTTGTTACGCGTGACC
GTGCAATGGAGAGTCTTATTCAAAATGGTGAAGAATGGATGGCTCCTCTTCTGGAGTTCCGAAATAAGTT
AGCAATGACAACGGATCCAGCGAACAAGGAAGAATACCGAAACCACAAACGTCGAACCGGTAAAGTAAGC
TACCAATACGCCAAAGAAGGTGAAGATATAGCTAGCGAGCGAAAGCACGTACCGGGCCCTTACTGGCTTA
AATACCGTCGCCAATGGCTTCGTGAACTTCTAGAACTAGATAAGAAGTTTAAAGCTGAAGGCCGAGAGAT
TGAGCTAATCACGGTGCCAGAGCTACATGCTATTCGTCAAGAATGGATCAAAGATCCAAATGAACCAGAC
TGGGATGACTCTCTACCGACCCTTTTCAAAGACGTTTATGGCTATGACCTAGATTGGGTATACGACGATA
ACGCGAGTTTTGGTAAAGATGACGCTCAGTTAATTCATGAGCTTTGTGACAACTTCGATGTTGAGCCCGA
GATGATCATGAAACTGATCGAGCTGGAAGTTTCTATGGAAGGCTTAAGCCGCCGTAGCGGTATTTCAAAC
AAAATTGCATCGCTATTGAAGCGAGACTGGGGAAGCTTGGAAGATATTAAACAAAAACATGCTTCCCTAC
AGAGTAAGGCTGAGTTTGATATTCACCAAAAAGAAATTGAGCGTTATAACGAACAACTTGCTGACTTAGA
TAAGCAGCTTCAAAAAGAGTTTTAA