Summary Sequence Context  
1 homologue found:

HomologuedndD
OrganismVibrio fischeri MJ11
GID1088
PID2088
Locus tagVFMJ11_A0169
Locations190660..192624
Length1965 bp
G+C%41.4
Link NCBI: gi:197336667  
SequenceGTGCATGAAATCGACCTGCGCCCTGCTCCTGCTCGTCTAAGTAAAAATGGTCCAATTGAAGGAACCGAAC
GACCAATCATTCTGTTTGGTGGTCTTAACGGTGCTGGTAAAACATCGATTCTGACAGCAGTACGATTCGC
TCTTTTTGGCCGTCAATCATTTAGCCAAGTACTATCAAATGGCGAGTACGTGGATGCCCTATCCGAGCTT
ATTCATAAAGGTGTCGGCCATGGCGGCGTTCAAGATAACGCATCGATCGAACTTGAGTTTAAATACAGCC
AAAACGGTGAAGAGAACACTTATAAAGTGATTCGCGGTTGGAAGCGCGGTAAGAAAGATAACCTGTACCT
TGAGAAAGATGGTATTCAAATTCCTGAGTTGAATTACGAGCAGTGCCAAGGTTTTCTTAATGAGCTTATT
CCAACGGGTATTGCTGATCTGTTCTTCTTCGACGGCGAGAAAATCGCTGAGCTAGCAGAAGATGAATCTG
GTAGCGTTCTTAAAACAGCTGTGCGTCGTCTACTTGGTTTAGATGTAATCGCGAAACTAAAAAGCGACCT
CAACATTTTCTTAAAGAAACAAGGAGCAGGAGCTTTAAGTCAGTCTTTAAAAGAAGAAATGGATAATCTC
GAGAACATTCGAATTAAACATGAAAGAGAAGCTGACAAGCTCCGATTTGAAGCCGAGAACGAAGTATATA
AGCAGATTATTCATACTAGTTCCGACATCCAAATTTTGGAGAACAAGCTTTCACAGAATGGTGGAGCTTG
GGCAAAAACCAGAGAAGATGAGCAACACAAAGTTGAAAACTTGCTTAAAGAGAAAGTCGAGCTTGAGAAA
CAGATTCGTATGGAAATGGAAACGAACCTTCCATTTTCACTTGCTCCGAAAGCAATGCAAAGGCTTCAAA
CTCAGATCAAACAAGAGCAACAAGTTAAGAAAAAGCAGAACTTTGGTAATGAGCTAGATGCTTTCCTAGA
AACTCTATGCTCAAAATACCCAAGCTTTGATACCGAGATGGCGCAAAACGCAATTGCAGATAGCTTTAAA
GAACACGTAGGTGAATTCGATTCAACAGAGCTTCTTTTGGATATCTCTGATCGCCAAGCGAATACCATCG
ATTACCAATTATCTAACCTATCGCAAGATTCTTTCTCTCGTTTCGACAAAGCACGAGTACGCCTCAGCAA
AGTCGAAGAAGAGATCGACAACGCTTCAAACAATATCGCGCGAGCACCAGAGCAGGAGCAAGTGCAGGAG
TTGTTTGCAGATGTCCGCGCTTTAGATAAGAAAAAAGAAAAGCTGATTATCGAATATCATGACTTGCTGG
AAAAGGCTAAGCAAGAACTTCGACTAGCTTTAGAAACAGCACGCAAAATTCAGAAGCTGCACGATAAAAA
CAAAGATCAATCGAGTAAAGATCAAAGCGTTAGCAATGCTCAAAACTCTATCTTATTACTAGAGAAGTTT
GGAGAGCAGTTAACTAAAGCGCGTGTTAATCAGTTAGAAAATGAATTCGTTCAATCATACAAAAAATTAG
CGCGTAAGGAAGATTTACAACTAACAGCTTCAATCAACCCAGCAACATTCGATGTTGAGTTAGTTGATGA
ACATGGTATTAAAATCAACCGTAAGGCGATGTCTGCTGGTGAGAAGCAGATCTACGCGATCTCGATTCTA
GAGGCTCTTGGCCGTACATCTGGTCGTAAACTTCCAATCATCATTGACACACCACTAGGTCGATTGGATT
CACATCACCGTGACAAACTGGTTGAGAACTATTTCCCAACCGCAAGCCACCAAGTTGTGATTTTATCGAC
TGATACAGAAATCGATAGAAATTATACAAACCTCATCCAAGACGATATTGCTCGCACTTACGAGATCTGT
TTCGACGGTACAACTAAGGCTTCAACGTTGAAAGAAGGTTACTTCTGGAAAGAATCGATTAAGGAGGCCA
TGTAA