Summary Sequence Context  
1 homologue found:

HomologuedndE
OrganismVibrio fischeri MJ11
GID1089
PID2089
Locus tagVFMJ11_A0168
Locations190313..190660
Length348 bp
G+C%42.5
Link NCBI: gi:197336667  
SequenceATGCTACCTAACCGCATGAACTTGACTCGCTCTACAGAAGAGCAACTTAAGAAGTTGAAGGGCTATACTG
GAATCACTCCAAACGTATCGGCTCGTATCGCTTTCTTCCGCTCAATTGAAAGTGACTTTCGATACCAAGG
CCAAGAAGCTAAGTTGGACGGCTCACTTGTACTAGATAAGTACACGTGGCTTGGTGAAACTAGTGATGTG
ACTGAACTAATGTTGAAGATGTACTACCCAGAGTTTGATACCAAAGAGTATCAACAAGCTTGGGCAGCAC
ATGTTGAAGATGGGATTGCTGCACTAAGAAACCATAAGAATCTGTTAGGCTTATCAATCAACCTATAA