Summary Sequence Alignment 16S rRNA Context  
4 homologues found:

HomologuedndB
OrganismClostridium botulinum E3 str. Alaska E43
GID1090
PID2090
Locus tagCLH_1923
Locations2068299..2069387
Length1089 bp
G+C%27.8
Link NCBI: gi:188587536  
SequenceATGAAAAATAATTTTTTTTATACCTTTCCTGCAATCAAAGGAAAACAAGCAACAAGGGACTTTTTTATTA
TAATGTGTCCCCTAAAAATATTATCAAAATTATTTATATTCAATGATGATGATTTACCACCTGAACATCG
TGCACAAAGAATTTTAAATAAGGCACGTATTCCAGAAATGGCATCATATATTGTTAATAATCCAAAGGAT
TATGTGTTTTCATCATTAACAGCATCTATCGATGGTGATTTTGAATTTTCACCCATTGATAAAGCATTTG
ATGAAAAAATAGGCACTCTTAAGGTAGCTATGGATAGCAGACTGCTTATAAATGATGGTCAACACAGAAG
GGCTGCCATTGAGGAAGCATTAAAGGCTGATACTGAAATAGGTGATGAAACAGTATCGGTTGTTTTATTT
ATAGATGAGGGTTTAAAACGTAGTCAACAAATATTTGCTGATTTAAATAAGCATGCTGTTAATGTGTCAA
AATCTATTGGAATTTTATATGACTCTCGTGATCCAATTGCAATGATTACAAGATCACTACTTGAGAAAAA
TGATTATTTAAAACATTATACAGATAAAGAGAATCCTTCTTTATCAAAATTTTCACCTAAGTTATTTACT
TTAAGTAGCATAAATGAAACTAATAAAAAGTTATTAAATAAATTAAACACTAATGATCCAAAAGTAATTT
CTTTTGTAAATGAATTTTGGGATGTTTTATGTGAAAATATGAAGGAATGGCAATTTGTATTTAACAAAGA
TACAAATCCTACTTTATTTAGAAAAGACTATATAAGTTCAAATGGAGTTGTACTTGAAGCTCTTGGTCTA
GTTGGTAATTACCTATATAAAAATAACTCTTATGATTGGAAAAAAATTCTTTCATATATTAAAAATATAG
ATTGGCATAGAACTAATCTAGATGATTGGCAGAATAGAGTAATTGGTCCAACAGGTAGAATTGTTAAAAG
TGCTACTTATGTAAGACTTACTAATAACTTAATAAAAGTTAAATTAAATATTCCTTTATCAAAAGATGAG
CAAAAATTAGAAAATGACTGTAAAAGGAAGGTTAACTAA

HomologuedndC
OrganismClostridium botulinum E3 str. Alaska E43
GID1091
PID2091
Locus tagCLH_1924
Locations2069387..2071015
Length1629 bp
G+C%28
Link NCBI: gi:188587536  
SequenceATGAATACTGAATTACAACAGAAAATACACAATATAATTGATGAAATGAAAATGGTATATAAAAATGACA
ATAGACCATGGGTTATAGGTTATAGTGGCGGTAAAGATAGTACCGCTGTAGTTCAATTGGTTTTTAATAT
GCTTCAAAGTCTACCAACTGAAGAAAGGCATAAAGATGTTTACGTAGTTTCTTCTGATACACTAATTGAA
AATCCTATTGTTTTAGGATACTTAAAACATAACTCTATATTAATTAATGAAGGTGCAAAAAAAGCTAATA
TACCACTATATACTTATATGGTTCATCCAGATTACAATAATACTTATTGGACTAATATAATTGGTAAAGG
CCTTCCTACCCCTACTTCTATAAGATTTAGATGGTGTACTGAACGTTTAAAAATTAAACCATCAAATAAA
TTTATTGAAGAAAAGGTTAAAGAAAGTGGCGAAGTTGTTGTTGTTTTAGGTGTTAGAAAATCTGAAAGTA
TCGCAAGAGGTATAAGAATTAGAAATCGAGAAATCGAAGGCTATCTTTTAACACCTCATGTAACTTTAGA
AAACACTTACGTTTATAATCCTATTGTAGAATTAACCACAGATGATGTTTGGGGGCTACTTCTATCAGAT
AATGGTTCTACGCCTTGGGGCACTAGCAATAATGATCTATTTACATTATATACAGGTGGTGAAGGTGGTG
AATGTCCTTTTACTACTACAAGCGACAAAGATACTCCATCATGTGGTAATTCAAGATTTGGTTGTTGGAT
TTGTACTGTTGTAAATAAAGATAAATCATTAAATGGATTTATTAAAAGTGGAGAAACTTGGCTTCAACCA
TTACTTGACTTTAGAGAATGGATTATAAGTATTCGTAATAGACACGAGTATAGAATGCAGTATAGACGAG
ACGGAAATCACTATTACAAAAAATTATATTTAGATAAATTACCTTTATTAAATGATTATATTATTAATTC
TGATTATATTTTTGCTAATCAAGATGGTGAAGGCTATATTGATTTTAAAAATTGTCAATCAGAAATATAT
AAAGGCAATACTTTTATTTCTACAGACAAAGATAAAGTTTATTTAGAACTACTTCCTCTTTTAAGTGTTA
CAAATTCAAATGACATAAAATTAGATAAATCCAAAATACAGAAAGATGATAAAGGTGACTTTGTAAATGT
GCTTGGATATGGACCTTTTAATTTTGAAGGTAGACAATTAATATTAAAAAAATTGTTAGAAGTACAAAAA
CATATTAATGAAGAATTCGAAATTGAACTTATTACTAAAGAAGAACTTGAAATTATTGATAGCATATGGG
ATGAAGAAGAAGATTTAACTAGAAGAACTCTAGTTGATTTATATTATGAGGTTATGGACGAAAGACTGCC
TTGGGATACTTATAAAAAACCTATGTTTGATGAAGCTACAAGAAGTGAAATAGAAAAATTATGCACTACT
CATAACCTAGATAAAGATTTAATTAATAAACTTTTAATTGAAACCAATAAATATAAGCATTTTACAAATA
AAACTGTTTTAGATAAATCAATTACTAAAATTCTTAATCAAAGACACTTACACAAATCAATTATTGAGGA
GATAGAAAATGATAATTAA

HomologuedndD
OrganismClostridium botulinum E3 str. Alaska E43
GID1092
PID2092
Locus tagCLH_1925
Locations2071005..2073164
Length2160 bp
G+C%23.4
Link NCBI: gi:188587536  
SequenceATGATAATTAACAGCATAACCTTAAAAAACTTTAGATCATACGAAGATAAAACTACCTTCTCATTTACTC
CTAAAGGGAATAAAAATATTGTTTTAGTAGGTGGAGAAAATGGAGCCGGTAAATCAACTTTATTTGAAGC
TATAAAATTATGTATTTATGGTCCAATTACTTATGGCTACCTTGGATTAAATCATAATTACTTAACTAAA
ATTAAAAATAACATAAATGATAATGCATTTAAGAATGAAGATATTGAATGTTATGTAGGTCTAAGTATTT
CTTTTAAAGAAGGCACACAAATTAAAGACTACTATTTAAAGCGTTCTTGGAATTATATAAATCAAAAAAT
ACATGAAGATTTTAAAGTTTCTCTAAATGATACAGAATTAAATGATGAAGATAAATTATACTTTGATAAA
TATTTAAAATCTGTAATTCCACCATCATTATTTGATTTCTTCTTTTTTGATGGTGAAGAGTTAAGTGAAT
TCTTTACAGGTAAAAGTGCATGTTCTAATTTAAAAGAATCAATACTTGAGCTATTCAATTATGATACATT
CGAAGTACTAAAGAAACAATTATTAGCTCATCAAAGAGCAAAATCAAAATCAAATATTAAATTAGAAGAT
GCACAAAATAATTTTGATTTACTTAGTTCTAAGGTTAAAGATTTAAAATTAGAAATTGAGAATTTAGAAA
AAACATTGCTTTTAGATGAAGAACTTCTTGATACTTTGCTAGTTAAAAGAAATGGAATTGAGGATGATTT
TAAAAGTAGTGGTGGACTTTTAGAAGGTGAGAAAGCTGTTTTAAATTCTGAAATTGCTAAAATTGAAAAT
GATCGTACTAATATTAATGTAGAAATTAAGGATTTTTGTAACGACAAACTACCTTTTTTATTAGTTACTG
ATCTTTTAGAAGAAACTAAAATTCAGATAGAGAAAGAAGATTCCTTAACTTCATATAATTCGATAAGTAA
AAAGTTATCTGGAGATATTGTAAAAGGAGCTTTAGTTAAACATATTCCTCCAAAAGTAAAAAATATTAAT
TTTAATGAAATTGCTGTAGATCTCCTTAACAATATGTTTAACACTGTTGAATTAAATAATGTAGCTAACA
TTTTAGAATTATCTACTGAACAAAGAAACACTATTACTCATACTATTGATAACATTTTAAATAAAAGAAA
CACTTTAACTAAATCTATCTTTTCTAAATTTGATAGTATTTCACAAATTGCCACTAAACTAAAGAAATTA
AGAAGTAAATTAAACTCATCTATTTCAGATGATATTTTAAATAGTTATTTAGAAAATCTACATTCTATTA
ATGAAGAAATTAATGTCATTCAAAAAAATCTTGCTGTAAAAAAAACAACAATTGAATCAAAATATGATGA
ACTTAAAAATAAAGAATATCATCTTACTAGAGCAAGAAATGAATATACTACATTACTTCAAAATAGTAAT
GTCTTAGATATGTCTACACAACTTATTGAATATTTAAGCGAACTTCTTACTAATTTAACTAAAGATAAAA
TTACATTAATAGAAAATGAATTTATAAAAATCTTTAGTAAAATAATTAGAAAAAATAATTATGTAAATAG
TATTGTGATTGATGATAATTTTAATACCACTCTTTATATAAATAAAGATTACAATAGTACAGAGATATTA
AATGTAATAAATAATCTTGGATTTGATGGTTTAATTAAAAAGTATGGAGATAAATTCTTAGAAGATTTAT
TAAATCATTATAAAGTAAATAGCCATAAAGAGCTTAAATCTCTAATATCAAGTGATATTTCATTTAATTA
TATTTGCTTAAGTACTAAAATTAATATAAATGATTTTTCAAATGGTGAAAAACAAATCTATATACTTTGC
TTAATTTGGGCTATTATTAAAAGTTCTGGTGTTGAAATACCATTTATAATTGATACGCCTTATGCTCGTA
TAGATGAAACACATAGAAATTCATTGACTACTGCTTACTTACCAAAGATAAGTAAGCAAGTAATAATTCT
TTCTACTAATAAAGAAATAGATAATGAACTATATAAAGTGGTAAAACCGTATGTATGTGATGAATACTTA
CTTCTATATAATACAGAATTACGTAAAACTGAAGTTAAAAATGGATATTTTGAGGTGTAA

HomologuedndE
OrganismClostridium botulinum E3 str. Alaska E43
GID1093
PID2093
Locus tagCLH_1926
Locations2073167..2073556
Length390 bp
G+C%27.9
Link NCBI: gi:188587536  
SequenceATGGGATTTAGATTAAAAACATCAAAAAAAACAAAAGAGATATTTGAAGAGGTAGGAAAAAGTGCAAATC
TTAAACCATTTGCTTTAAGTAAAATAGCAGTTTCACTATCATTAAAAGATAAAACTTCTATATTAGAATA
TAAAAATAACGATACAAATGGCCTTGAGCTACAGAGAGCTACAGTTACGGGTGAATTTGATGCTATATTT
AAAGCTCTTATTGAAGTAAATCTTGGTCGTAATATAAATGATGATGAGTACTATCCACACTTTATGAAAC
TTCATATAGATAGAGGTGCTGAACTTCTTTTAAGTCAATATAAATATAGTGGTGGAAATTTAGAAAAATT
CTTAAAAAATGCATTAAAAAAGGGAGATGCTAACTTATGA