Summary Sequence Context  
1 homologue found:

HomologuedndB
OrganismClostridium botulinum E3 str. Alaska E43
GID1090
PID2090
Locus tagCLH_1923
Locations2068299..2069387
Length1089 bp
G+C%27.8
Link NCBI: gi:188587536  
SequenceATGAAAAATAATTTTTTTTATACCTTTCCTGCAATCAAAGGAAAACAAGCAACAAGGGACTTTTTTATTA
TAATGTGTCCCCTAAAAATATTATCAAAATTATTTATATTCAATGATGATGATTTACCACCTGAACATCG
TGCACAAAGAATTTTAAATAAGGCACGTATTCCAGAAATGGCATCATATATTGTTAATAATCCAAAGGAT
TATGTGTTTTCATCATTAACAGCATCTATCGATGGTGATTTTGAATTTTCACCCATTGATAAAGCATTTG
ATGAAAAAATAGGCACTCTTAAGGTAGCTATGGATAGCAGACTGCTTATAAATGATGGTCAACACAGAAG
GGCTGCCATTGAGGAAGCATTAAAGGCTGATACTGAAATAGGTGATGAAACAGTATCGGTTGTTTTATTT
ATAGATGAGGGTTTAAAACGTAGTCAACAAATATTTGCTGATTTAAATAAGCATGCTGTTAATGTGTCAA
AATCTATTGGAATTTTATATGACTCTCGTGATCCAATTGCAATGATTACAAGATCACTACTTGAGAAAAA
TGATTATTTAAAACATTATACAGATAAAGAGAATCCTTCTTTATCAAAATTTTCACCTAAGTTATTTACT
TTAAGTAGCATAAATGAAACTAATAAAAAGTTATTAAATAAATTAAACACTAATGATCCAAAAGTAATTT
CTTTTGTAAATGAATTTTGGGATGTTTTATGTGAAAATATGAAGGAATGGCAATTTGTATTTAACAAAGA
TACAAATCCTACTTTATTTAGAAAAGACTATATAAGTTCAAATGGAGTTGTACTTGAAGCTCTTGGTCTA
GTTGGTAATTACCTATATAAAAATAACTCTTATGATTGGAAAAAAATTCTTTCATATATTAAAAATATAG
ATTGGCATAGAACTAATCTAGATGATTGGCAGAATAGAGTAATTGGTCCAACAGGTAGAATTGTTAAAAG
TGCTACTTATGTAAGACTTACTAATAACTTAATAAAAGTTAAATTAAATATTCCTTTATCAAAAGATGAG
CAAAAATTAGAAAATGACTGTAAAAGGAAGGTTAACTAA