Summary Sequence Context  
1 homologue found:

HomologuedndC
OrganismClostridium botulinum E3 str. Alaska E43
GID1091
PID2091
Locus tagCLH_1924
Locations2069387..2071015
Length1629 bp
G+C%28
Link NCBI: gi:188587536  
SequenceATGAATACTGAATTACAACAGAAAATACACAATATAATTGATGAAATGAAAATGGTATATAAAAATGACA
ATAGACCATGGGTTATAGGTTATAGTGGCGGTAAAGATAGTACCGCTGTAGTTCAATTGGTTTTTAATAT
GCTTCAAAGTCTACCAACTGAAGAAAGGCATAAAGATGTTTACGTAGTTTCTTCTGATACACTAATTGAA
AATCCTATTGTTTTAGGATACTTAAAACATAACTCTATATTAATTAATGAAGGTGCAAAAAAAGCTAATA
TACCACTATATACTTATATGGTTCATCCAGATTACAATAATACTTATTGGACTAATATAATTGGTAAAGG
CCTTCCTACCCCTACTTCTATAAGATTTAGATGGTGTACTGAACGTTTAAAAATTAAACCATCAAATAAA
TTTATTGAAGAAAAGGTTAAAGAAAGTGGCGAAGTTGTTGTTGTTTTAGGTGTTAGAAAATCTGAAAGTA
TCGCAAGAGGTATAAGAATTAGAAATCGAGAAATCGAAGGCTATCTTTTAACACCTCATGTAACTTTAGA
AAACACTTACGTTTATAATCCTATTGTAGAATTAACCACAGATGATGTTTGGGGGCTACTTCTATCAGAT
AATGGTTCTACGCCTTGGGGCACTAGCAATAATGATCTATTTACATTATATACAGGTGGTGAAGGTGGTG
AATGTCCTTTTACTACTACAAGCGACAAAGATACTCCATCATGTGGTAATTCAAGATTTGGTTGTTGGAT
TTGTACTGTTGTAAATAAAGATAAATCATTAAATGGATTTATTAAAAGTGGAGAAACTTGGCTTCAACCA
TTACTTGACTTTAGAGAATGGATTATAAGTATTCGTAATAGACACGAGTATAGAATGCAGTATAGACGAG
ACGGAAATCACTATTACAAAAAATTATATTTAGATAAATTACCTTTATTAAATGATTATATTATTAATTC
TGATTATATTTTTGCTAATCAAGATGGTGAAGGCTATATTGATTTTAAAAATTGTCAATCAGAAATATAT
AAAGGCAATACTTTTATTTCTACAGACAAAGATAAAGTTTATTTAGAACTACTTCCTCTTTTAAGTGTTA
CAAATTCAAATGACATAAAATTAGATAAATCCAAAATACAGAAAGATGATAAAGGTGACTTTGTAAATGT
GCTTGGATATGGACCTTTTAATTTTGAAGGTAGACAATTAATATTAAAAAAATTGTTAGAAGTACAAAAA
CATATTAATGAAGAATTCGAAATTGAACTTATTACTAAAGAAGAACTTGAAATTATTGATAGCATATGGG
ATGAAGAAGAAGATTTAACTAGAAGAACTCTAGTTGATTTATATTATGAGGTTATGGACGAAAGACTGCC
TTGGGATACTTATAAAAAACCTATGTTTGATGAAGCTACAAGAAGTGAAATAGAAAAATTATGCACTACT
CATAACCTAGATAAAGATTTAATTAATAAACTTTTAATTGAAACCAATAAATATAAGCATTTTACAAATA
AAACTGTTTTAGATAAATCAATTACTAAAATTCTTAATCAAAGACACTTACACAAATCAATTATTGAGGA
GATAGAAAATGATAATTAA