Summary Sequence Context  
1 homologue found:

HomologuedndD
OrganismClostridium botulinum E3 str. Alaska E43
GID1092
PID2092
Locus tagCLH_1925
Locations2071005..2073164
Length2160 bp
G+C%23.4
Link NCBI: gi:188587536  
SequenceATGATAATTAACAGCATAACCTTAAAAAACTTTAGATCATACGAAGATAAAACTACCTTCTCATTTACTC
CTAAAGGGAATAAAAATATTGTTTTAGTAGGTGGAGAAAATGGAGCCGGTAAATCAACTTTATTTGAAGC
TATAAAATTATGTATTTATGGTCCAATTACTTATGGCTACCTTGGATTAAATCATAATTACTTAACTAAA
ATTAAAAATAACATAAATGATAATGCATTTAAGAATGAAGATATTGAATGTTATGTAGGTCTAAGTATTT
CTTTTAAAGAAGGCACACAAATTAAAGACTACTATTTAAAGCGTTCTTGGAATTATATAAATCAAAAAAT
ACATGAAGATTTTAAAGTTTCTCTAAATGATACAGAATTAAATGATGAAGATAAATTATACTTTGATAAA
TATTTAAAATCTGTAATTCCACCATCATTATTTGATTTCTTCTTTTTTGATGGTGAAGAGTTAAGTGAAT
TCTTTACAGGTAAAAGTGCATGTTCTAATTTAAAAGAATCAATACTTGAGCTATTCAATTATGATACATT
CGAAGTACTAAAGAAACAATTATTAGCTCATCAAAGAGCAAAATCAAAATCAAATATTAAATTAGAAGAT
GCACAAAATAATTTTGATTTACTTAGTTCTAAGGTTAAAGATTTAAAATTAGAAATTGAGAATTTAGAAA
AAACATTGCTTTTAGATGAAGAACTTCTTGATACTTTGCTAGTTAAAAGAAATGGAATTGAGGATGATTT
TAAAAGTAGTGGTGGACTTTTAGAAGGTGAGAAAGCTGTTTTAAATTCTGAAATTGCTAAAATTGAAAAT
GATCGTACTAATATTAATGTAGAAATTAAGGATTTTTGTAACGACAAACTACCTTTTTTATTAGTTACTG
ATCTTTTAGAAGAAACTAAAATTCAGATAGAGAAAGAAGATTCCTTAACTTCATATAATTCGATAAGTAA
AAAGTTATCTGGAGATATTGTAAAAGGAGCTTTAGTTAAACATATTCCTCCAAAAGTAAAAAATATTAAT
TTTAATGAAATTGCTGTAGATCTCCTTAACAATATGTTTAACACTGTTGAATTAAATAATGTAGCTAACA
TTTTAGAATTATCTACTGAACAAAGAAACACTATTACTCATACTATTGATAACATTTTAAATAAAAGAAA
CACTTTAACTAAATCTATCTTTTCTAAATTTGATAGTATTTCACAAATTGCCACTAAACTAAAGAAATTA
AGAAGTAAATTAAACTCATCTATTTCAGATGATATTTTAAATAGTTATTTAGAAAATCTACATTCTATTA
ATGAAGAAATTAATGTCATTCAAAAAAATCTTGCTGTAAAAAAAACAACAATTGAATCAAAATATGATGA
ACTTAAAAATAAAGAATATCATCTTACTAGAGCAAGAAATGAATATACTACATTACTTCAAAATAGTAAT
GTCTTAGATATGTCTACACAACTTATTGAATATTTAAGCGAACTTCTTACTAATTTAACTAAAGATAAAA
TTACATTAATAGAAAATGAATTTATAAAAATCTTTAGTAAAATAATTAGAAAAAATAATTATGTAAATAG
TATTGTGATTGATGATAATTTTAATACCACTCTTTATATAAATAAAGATTACAATAGTACAGAGATATTA
AATGTAATAAATAATCTTGGATTTGATGGTTTAATTAAAAAGTATGGAGATAAATTCTTAGAAGATTTAT
TAAATCATTATAAAGTAAATAGCCATAAAGAGCTTAAATCTCTAATATCAAGTGATATTTCATTTAATTA
TATTTGCTTAAGTACTAAAATTAATATAAATGATTTTTCAAATGGTGAAAAACAAATCTATATACTTTGC
TTAATTTGGGCTATTATTAAAAGTTCTGGTGTTGAAATACCATTTATAATTGATACGCCTTATGCTCGTA
TAGATGAAACACATAGAAATTCATTGACTACTGCTTACTTACCAAAGATAAGTAAGCAAGTAATAATTCT
TTCTACTAATAAAGAAATAGATAATGAACTATATAAAGTGGTAAAACCGTATGTATGTGATGAATACTTA
CTTCTATATAATACAGAATTACGTAAAACTGAAGTTAAAAATGGATATTTTGAGGTGTAA