Summary Sequence Context  
1 homologue found:

HomologuedndE
OrganismClostridium botulinum E3 str. Alaska E43
GID1093
PID2093
Locus tagCLH_1926
Locations2073167..2073556
Length390 bp
G+C%27.9
Link NCBI: gi:188587536  
SequenceATGGGATTTAGATTAAAAACATCAAAAAAAACAAAAGAGATATTTGAAGAGGTAGGAAAAAGTGCAAATC
TTAAACCATTTGCTTTAAGTAAAATAGCAGTTTCACTATCATTAAAAGATAAAACTTCTATATTAGAATA
TAAAAATAACGATACAAATGGCCTTGAGCTACAGAGAGCTACAGTTACGGGTGAATTTGATGCTATATTT
AAAGCTCTTATTGAAGTAAATCTTGGTCGTAATATAAATGATGATGAGTACTATCCACACTTTATGAAAC
TTCATATAGATAGAGGTGCTGAACTTCTTTTAAGTCAATATAAATATAGTGGTGGAAATTTAGAAAAATT
CTTAAAAAATGCATTAAAAAAGGGAGATGCTAACTTATGA