Summary Sequence Alignment 16S rRNA Context  
4 homologues found:

HomologuedndB
OrganismCitrobacter koseri ATCC BAA-895
GID1094
PID2094
Locus tagCKO_03498
Locations3260761..3261846
Length1086 bp
G+C%44.3
Link NCBI: gi:157144296  
SequenceATGCATGATCGTAACCAGACAAATTACTTTTACATGTTTCCTGCGGTACGTGGAATGCAGGCAGGAAGAG
AGTTTTACATTGCGACCTGCCCATTGCTGACAATTCCAAAGATTTTCAGCTTTGATGAAGAAGAGGTTCC
ACCTGAACTGCGGGCGCAGCGCTCATTAAATAAAGCACGGATACCCGACATGGTGCGTTATCTGTTGGAT
AATCCAGATAACTATATTTTTTCTGCACTTACCGCTTCTGTTGCTGTTGATGTGCATTTTGAAGCAATTA
ACGATGCTGGGAGTCTGGGTACGTTACAAGTGCCTATGGGAGCCCAAATTTTGATTAATGACGGGCAGCA
TAGACGAAAGGCTATCGAAGAAGCATTAAAAGCAAACCCTGAGCTGGGATATGACAACATTCCGGTTTTG
TTCTTCGTTGATCGGGGGTTAGTGAGAAGCCAACAGATGTTTGCTGATTTGAACAAATACGCGGTTAGAC
CAAGCCCTTCGTTGGCGACCCTCTATGATCACCGAGATCCAAGCGCTCAACTTGCCTGCCATCTGGCTGA
AAATATTGAGCCGTTTATTGGTTTCACAGAAATGGAAAAATCAAGCATATCATCGCTTTCCAATAAGCTT
TTTACGTTGAGCAGCATCAAGCAGGCGACGAAAGCATTACTCGGTAAAGGGCTGAAAGATTTGTACTCCG
ATGACGAAAAGCATAAAGCGGAACGTTTCTGGCGTGCTGTGTTTGGAGTTATGCCCGAATGGCAAATGGT
ACGACGCCGTGAGATTTCTCCAGCGAGTATGCGTCAGGAATTTATCCATTCTCACGGTGTAGGTTTACAG
GCCATCGGTTTGATGGGTAAGGGATTGCTACAACATTCGCCATATAACTGGGAGCAAAAGTTGGAAGGTT
TGAGAGATATTGACTGGCGAAAGGCGAATCCGGAATGGCTAAAACGCACGATGCTGCATGGAAAAATCAG
CAAATCAGCGATATCGATACACTTAACCAGTAATGCTCTGAAACAGAAACTCGGCATTCCTTTAAATTCA
GAAGAACAAAAATTAGAAGAGCAACTGAAGTCATGA

HomologuedndC
OrganismCitrobacter koseri ATCC BAA-895
GID1095
PID2095
Locus tagCKO_03497
Locations3259130..3260764
Length1635 bp
G+C%41.7
Link NCBI: gi:157144296  
SequenceATGAGTCATTTATTACAAGCATATGATCTTGATAGTTACGAAGATTTTATTAATCAGGAAACCTTTGCTG
GGCGTCCATTACATGAATTTGTATCTGAGATCCAGCGGATCTATCTGGCTGATAAACGTCCTTGGGTTAT
TGGCTACAGTGGCGGTAAGGATTCGTCTGCTGTAACAACTCTTATTTATCTGGCATTACTGGGATTGTCT
CCCGAGCAGCGTAATAAGCCTGTTTTTGTCGTATGTTCAGATACTTTGGTCGAGACACCAGTAGTTGTAA
ACCTGATCAGTCGAACATTGAAGCTAATAGAAAGAGGTGCTCGCCAGGATGGTTTGCCCATATTGGTGCA
ACAAGTTGTTCCTAAAACGCATGAAACATTTTGGGCAAACCTTTTAGGAAAGGGATATCCGGCACCTACT
CGGCAGTTCCGCTGGTGTACCGAACGTATGAAAATCAATCCGGTTAGTGACTTTATTCGAGATAAAGTAA
GTCAGTTCGAAGAAGTTATTGTGGTTTTAGGGTCCCGTTCTGCAGAAAGTGCATCCCGTGCTCAGGTAAT
TGCAAAACACAAGATTGATGGGACTCGATTAGCTCGTCATACCACCTTAGCTAATGCGTTTATCTATACC
CCTATTGATACTTGGGGGGTTGATGATGTCTGGAAATTGTTGAGAGGTGCATTCCGCTATTCAAGTGATG
TAACCGAATGGGAAACACCTTGGGGAGGTGGGAACAACCTTCCTTTATGGACTTTGTATATGGACTCCTC
TGGTCAGGGGGAATGCCCTATGGTTATTGATGACAGCACCCCGTCTTGTGGTAATTCGCGATTTGGGTGC
TGGACTTGTACTGTTGTAACCAAAGATCGGGCTATGGAAAGTCTAGTTCAAAACGGAGAGCAATGGATGG
CTCCGTTGTTGGAGTTTCGCAATATGCTTGCGAAGACTACTGAACCAGAAGAGAAAGATAAGTACCGTAA
CTTTAAGCGCCGAACTGGAAAGGTTAGTTATCAGTATTTAAAAGAGGGGGAGGATATTTCGGTTGAACGA
AAACATGTTCCTGGCCCCTATTTATTGAAATATCGACAAGAATGGCTGGAGAAGTTGCTCAACCTGGATA
AGGTCTTGAAAGCACAAGGACATGATATTCAGCTTATAACTGAAGGGGAGTTACATGCTATTCGTCAGGA
GTGGCTTAATGATCCTAATGAACCTGATTGGAATGATTCTCTGCCAAAAATCTATAAACGTGTATATGGT
CATGATTTAGCTTGGCAGATAGATGAACGAGTTCGTTTTGCTGGTGCAGATGCAGGACTACTTCATGAAC
TAGCCACTGAACATGGAATTGTCCCTGAGATGGTCATGAAGCTGATTGATCTTGAGATCTCTTTTGAAGG
AATGGGGCGCCGTCAAAATGTTCAAAAGAAAGTAGAATCGATATTACAACAGGATTGGGGAACATTTGAA
GAGATCAAGGAAAAATACTCTTCGGTTCAGAAAAAGAATCAATTCGATATGCTTTTAAAAGAAAAAGAAG
ATATTGAACTTGCTTTGGATGATCTATCAAATGATTTTGATAGGCTTGAGAACATATTAAATAGTGTGAC
CAGTAATGATGAGGTGGCAAAATGA

HomologuedndD
OrganismCitrobacter koseri ATCC BAA-895
GID1096
PID2097
Locus tagCKO_03496
Locations3257136..3259133
Length1998 bp
G+C%35.6
Link NCBI: gi:157144296  
SequenceATGATTATAACTAAACTGGTTATGCGTAATTTCCGCGTGTTTCGTGGTGAACATGTGCTCGATCTTGCTC
CAAATGATGAACCTGGAAAGCCACTAATTTTGATTGGTGGTCTTAATGGTTCTGGGAAAACTTCTATTTT
AACTGCAATACGACTTGCCTTGTATGGATCACAAGCATTTGATGATGTTTTTACCAAGAATTCCTATATT
GAGAGATTATCGTCTTTAGTCCATAACGGAAAACCTGATGATTTTGAAGATTTTACCTCTGCTTTTGTGG
AACTTAGTTTCACACTTCGAATTGATGGAGAAGATGTCACGTACTGTACAAAACGATCATGGTCAAAAGG
TAGGGGCGATCAACTCTCTATTTCTGAGAATGGGGTGCTTATGGAGGGAAAAAGCCCGGAGCAGTTACAG
GGTTTCCTAAATGAGCTGATCCCTGTTGGTGTTGGTGAATTATTCTTCTTTGATGGGGAAAAAATTGCCA
CGCTTGCAGAAGATGAGACTGGAAGCATTTTAAGGATAGCTATGCAACGTCTACTAGGACTTGACGTTGT
ATCTCGGTTAAAAGGAGATCTAAATACCTACATCAAAAATGATCAGAAAAACAAGCTTAATCGTGTTGCA
CAGGAACAAGTTAAAGTACTTGAAAAAAAGAAGAATGACCTTATTTCATATGCTAATGAAAAAAGAAGCG
AAGCACTCGATTATTTGAAAGGTATTGAATTAAATATCAAAGATTTACGTAAGTATGAAGCTTTATTGAT
GGCGCAAGGAAAAAATTTTGCAGACTCAAAAGTGAGTGAGGAAGCGAAATTAAGAAGTTTAGAGACTGAA
AAACTATATACAGAAAAGCAATTGCGTAATACCCTTGACGGATATTTCCCTTTTTCATTAGCGCCAAATA
TATTTAGAGATCTTTTTAACCAAGTAGAACTGGAAAAAGAAATAATAAAAGCTACCGCATTCAAGTCAGG
TCTTGATGATTTTCTGAAAAAACTCCGGAATGAATTGGCGATCCGGTCATCTACAACGTTGAAAATTGCT
ACAGAGACAATTGAAGATCAATTAAAAGATTTTCTATTGACTCAACCGTCCGGGGATATCCTGCTAGATG
TCTCTGAACGTGAGTCTGGTATTTTACATAATGCAGTCTACACATTATCGCCTAAATTAAAAAAAGAAAA
AAATAGACTTTGCGAAGAGATAAAAAGAATTGACTTGGCTATTGAACATGCAAAAGAAAATATCGAAAGA
TCTCCTGAGGAAGAACAGTTAAGTAGTACTTTCAATATTATTAGGACTTTTGACAAGAACATACGTGATG
CCGTAGATGAGTTTAAAAAACTACACCTTGATGCTAAAACAGCACTAACTGAAGCGTTAGAGTGTACTCG
AGAACAGCAGAAGCTTCATGACGCAATAAAGAATAAAGTTGCACTGGAAAATGCTAGTGATTATGCCCTA
TCTATATTACCTCTTCTTGATGAATACGCCAAAAAACTGACACAGAAGCGTATATCTGAAGTGGAACAAG
AGTTTTCTCGAGTATATAAGAAGTTGGCAAGGAAGGACGAGTTAAAATTACGAGCTAAAATTGATGTAAA
TACATTTAATGTGAATCTTCAAGATGAAGATGGATTAATAATTGATCGTAGTTTATTGTCTGCTGGTGAA
AAACAGATATATGCAGTCACTATGCTTGAAGCATTAGGGAATGTTTCTGGGAAATTACTTCCTATTATAA
TTGATACTCCTTTAGGAAGGTTAGACTCGCATCATAGAGATAAGTTAGTTGAACACTATATCCCAGATGC
TAGTCACCAGGTCATTATCCTATCTACCGATACGGAAATTGATGAGAGATATTACAAAAATTATCTCTGT
GATTGTATTTCAAAATCTTATGAAATAAGATACTCACCATTTAGTCAATCTTCAAAGATTGAAGACGGCT
ATTTTTGGAAAAATGCAAAATGTGAGGTGAATGCCTAA

HomologuedndE
OrganismCitrobacter koseri ATCC BAA-895
GID1097
PID2097
Locus tagCKO_03495
Locations3256789..3257136
Length348 bp
G+C%37.6
Link NCBI: gi:157144296  
SequenceATGTTACCTAATCGTTTGCAACTGAACATTCGTGTTGAAGATCAACTTAAAAGACTAAAAGCTAGCACGG
GGGTTAATCCAAATATTTCTGCTCGGATAGCATTTTTCCGTTCTGTAGAAAGTGGCTATCGTTTTGACGG
AAATGACTATAAAACTGATGGCAATATGAGTATGGATAAAGCTGTATGGTTGGGAGATACAGGTGTAGCT
ACTGAACTTATATTGAAGATGTTGTATCCCAATTTTGATGGAAAAAAAATGATGCAAGCTTGGGCTGCAC
ATGTTGACGATGGGTCTGCATCCTTGCGAAACCATCGTGAATTAATTAGTTTTACTACATCTCTTTAA