Summary Sequence Context  
1 homologue found:

HomologuedndB
OrganismCitrobacter koseri ATCC BAA-895
GID1094
PID2094
Locus tagCKO_03498
Locations3260761..3261846
Length1086 bp
G+C%44.3
Link NCBI: gi:157144296  
SequenceATGCATGATCGTAACCAGACAAATTACTTTTACATGTTTCCTGCGGTACGTGGAATGCAGGCAGGAAGAG
AGTTTTACATTGCGACCTGCCCATTGCTGACAATTCCAAAGATTTTCAGCTTTGATGAAGAAGAGGTTCC
ACCTGAACTGCGGGCGCAGCGCTCATTAAATAAAGCACGGATACCCGACATGGTGCGTTATCTGTTGGAT
AATCCAGATAACTATATTTTTTCTGCACTTACCGCTTCTGTTGCTGTTGATGTGCATTTTGAAGCAATTA
ACGATGCTGGGAGTCTGGGTACGTTACAAGTGCCTATGGGAGCCCAAATTTTGATTAATGACGGGCAGCA
TAGACGAAAGGCTATCGAAGAAGCATTAAAAGCAAACCCTGAGCTGGGATATGACAACATTCCGGTTTTG
TTCTTCGTTGATCGGGGGTTAGTGAGAAGCCAACAGATGTTTGCTGATTTGAACAAATACGCGGTTAGAC
CAAGCCCTTCGTTGGCGACCCTCTATGATCACCGAGATCCAAGCGCTCAACTTGCCTGCCATCTGGCTGA
AAATATTGAGCCGTTTATTGGTTTCACAGAAATGGAAAAATCAAGCATATCATCGCTTTCCAATAAGCTT
TTTACGTTGAGCAGCATCAAGCAGGCGACGAAAGCATTACTCGGTAAAGGGCTGAAAGATTTGTACTCCG
ATGACGAAAAGCATAAAGCGGAACGTTTCTGGCGTGCTGTGTTTGGAGTTATGCCCGAATGGCAAATGGT
ACGACGCCGTGAGATTTCTCCAGCGAGTATGCGTCAGGAATTTATCCATTCTCACGGTGTAGGTTTACAG
GCCATCGGTTTGATGGGTAAGGGATTGCTACAACATTCGCCATATAACTGGGAGCAAAAGTTGGAAGGTT
TGAGAGATATTGACTGGCGAAAGGCGAATCCGGAATGGCTAAAACGCACGATGCTGCATGGAAAAATCAG
CAAATCAGCGATATCGATACACTTAACCAGTAATGCTCTGAAACAGAAACTCGGCATTCCTTTAAATTCA
GAAGAACAAAAATTAGAAGAGCAACTGAAGTCATGA