Summary Sequence Context  
1 homologue found:

HomologuedndC
OrganismCitrobacter koseri ATCC BAA-895
GID1095
PID2095
Locus tagCKO_03497
Locations3259130..3260764
Length1635 bp
G+C%41.7
Link NCBI: gi:157144296  
SequenceATGAGTCATTTATTACAAGCATATGATCTTGATAGTTACGAAGATTTTATTAATCAGGAAACCTTTGCTG
GGCGTCCATTACATGAATTTGTATCTGAGATCCAGCGGATCTATCTGGCTGATAAACGTCCTTGGGTTAT
TGGCTACAGTGGCGGTAAGGATTCGTCTGCTGTAACAACTCTTATTTATCTGGCATTACTGGGATTGTCT
CCCGAGCAGCGTAATAAGCCTGTTTTTGTCGTATGTTCAGATACTTTGGTCGAGACACCAGTAGTTGTAA
ACCTGATCAGTCGAACATTGAAGCTAATAGAAAGAGGTGCTCGCCAGGATGGTTTGCCCATATTGGTGCA
ACAAGTTGTTCCTAAAACGCATGAAACATTTTGGGCAAACCTTTTAGGAAAGGGATATCCGGCACCTACT
CGGCAGTTCCGCTGGTGTACCGAACGTATGAAAATCAATCCGGTTAGTGACTTTATTCGAGATAAAGTAA
GTCAGTTCGAAGAAGTTATTGTGGTTTTAGGGTCCCGTTCTGCAGAAAGTGCATCCCGTGCTCAGGTAAT
TGCAAAACACAAGATTGATGGGACTCGATTAGCTCGTCATACCACCTTAGCTAATGCGTTTATCTATACC
CCTATTGATACTTGGGGGGTTGATGATGTCTGGAAATTGTTGAGAGGTGCATTCCGCTATTCAAGTGATG
TAACCGAATGGGAAACACCTTGGGGAGGTGGGAACAACCTTCCTTTATGGACTTTGTATATGGACTCCTC
TGGTCAGGGGGAATGCCCTATGGTTATTGATGACAGCACCCCGTCTTGTGGTAATTCGCGATTTGGGTGC
TGGACTTGTACTGTTGTAACCAAAGATCGGGCTATGGAAAGTCTAGTTCAAAACGGAGAGCAATGGATGG
CTCCGTTGTTGGAGTTTCGCAATATGCTTGCGAAGACTACTGAACCAGAAGAGAAAGATAAGTACCGTAA
CTTTAAGCGCCGAACTGGAAAGGTTAGTTATCAGTATTTAAAAGAGGGGGAGGATATTTCGGTTGAACGA
AAACATGTTCCTGGCCCCTATTTATTGAAATATCGACAAGAATGGCTGGAGAAGTTGCTCAACCTGGATA
AGGTCTTGAAAGCACAAGGACATGATATTCAGCTTATAACTGAAGGGGAGTTACATGCTATTCGTCAGGA
GTGGCTTAATGATCCTAATGAACCTGATTGGAATGATTCTCTGCCAAAAATCTATAAACGTGTATATGGT
CATGATTTAGCTTGGCAGATAGATGAACGAGTTCGTTTTGCTGGTGCAGATGCAGGACTACTTCATGAAC
TAGCCACTGAACATGGAATTGTCCCTGAGATGGTCATGAAGCTGATTGATCTTGAGATCTCTTTTGAAGG
AATGGGGCGCCGTCAAAATGTTCAAAAGAAAGTAGAATCGATATTACAACAGGATTGGGGAACATTTGAA
GAGATCAAGGAAAAATACTCTTCGGTTCAGAAAAAGAATCAATTCGATATGCTTTTAAAAGAAAAAGAAG
ATATTGAACTTGCTTTGGATGATCTATCAAATGATTTTGATAGGCTTGAGAACATATTAAATAGTGTGAC
CAGTAATGATGAGGTGGCAAAATGA