Summary Sequence Context  
1 homologue found:

HomologuedndD
OrganismCitrobacter koseri ATCC BAA-895
GID1096
PID2097
Locus tagCKO_03496
Locations3257136..3259133
Length1998 bp
G+C%35.6
Link NCBI: gi:157144296  
SequenceATGATTATAACTAAACTGGTTATGCGTAATTTCCGCGTGTTTCGTGGTGAACATGTGCTCGATCTTGCTC
CAAATGATGAACCTGGAAAGCCACTAATTTTGATTGGTGGTCTTAATGGTTCTGGGAAAACTTCTATTTT
AACTGCAATACGACTTGCCTTGTATGGATCACAAGCATTTGATGATGTTTTTACCAAGAATTCCTATATT
GAGAGATTATCGTCTTTAGTCCATAACGGAAAACCTGATGATTTTGAAGATTTTACCTCTGCTTTTGTGG
AACTTAGTTTCACACTTCGAATTGATGGAGAAGATGTCACGTACTGTACAAAACGATCATGGTCAAAAGG
TAGGGGCGATCAACTCTCTATTTCTGAGAATGGGGTGCTTATGGAGGGAAAAAGCCCGGAGCAGTTACAG
GGTTTCCTAAATGAGCTGATCCCTGTTGGTGTTGGTGAATTATTCTTCTTTGATGGGGAAAAAATTGCCA
CGCTTGCAGAAGATGAGACTGGAAGCATTTTAAGGATAGCTATGCAACGTCTACTAGGACTTGACGTTGT
ATCTCGGTTAAAAGGAGATCTAAATACCTACATCAAAAATGATCAGAAAAACAAGCTTAATCGTGTTGCA
CAGGAACAAGTTAAAGTACTTGAAAAAAAGAAGAATGACCTTATTTCATATGCTAATGAAAAAAGAAGCG
AAGCACTCGATTATTTGAAAGGTATTGAATTAAATATCAAAGATTTACGTAAGTATGAAGCTTTATTGAT
GGCGCAAGGAAAAAATTTTGCAGACTCAAAAGTGAGTGAGGAAGCGAAATTAAGAAGTTTAGAGACTGAA
AAACTATATACAGAAAAGCAATTGCGTAATACCCTTGACGGATATTTCCCTTTTTCATTAGCGCCAAATA
TATTTAGAGATCTTTTTAACCAAGTAGAACTGGAAAAAGAAATAATAAAAGCTACCGCATTCAAGTCAGG
TCTTGATGATTTTCTGAAAAAACTCCGGAATGAATTGGCGATCCGGTCATCTACAACGTTGAAAATTGCT
ACAGAGACAATTGAAGATCAATTAAAAGATTTTCTATTGACTCAACCGTCCGGGGATATCCTGCTAGATG
TCTCTGAACGTGAGTCTGGTATTTTACATAATGCAGTCTACACATTATCGCCTAAATTAAAAAAAGAAAA
AAATAGACTTTGCGAAGAGATAAAAAGAATTGACTTGGCTATTGAACATGCAAAAGAAAATATCGAAAGA
TCTCCTGAGGAAGAACAGTTAAGTAGTACTTTCAATATTATTAGGACTTTTGACAAGAACATACGTGATG
CCGTAGATGAGTTTAAAAAACTACACCTTGATGCTAAAACAGCACTAACTGAAGCGTTAGAGTGTACTCG
AGAACAGCAGAAGCTTCATGACGCAATAAAGAATAAAGTTGCACTGGAAAATGCTAGTGATTATGCCCTA
TCTATATTACCTCTTCTTGATGAATACGCCAAAAAACTGACACAGAAGCGTATATCTGAAGTGGAACAAG
AGTTTTCTCGAGTATATAAGAAGTTGGCAAGGAAGGACGAGTTAAAATTACGAGCTAAAATTGATGTAAA
TACATTTAATGTGAATCTTCAAGATGAAGATGGATTAATAATTGATCGTAGTTTATTGTCTGCTGGTGAA
AAACAGATATATGCAGTCACTATGCTTGAAGCATTAGGGAATGTTTCTGGGAAATTACTTCCTATTATAA
TTGATACTCCTTTAGGAAGGTTAGACTCGCATCATAGAGATAAGTTAGTTGAACACTATATCCCAGATGC
TAGTCACCAGGTCATTATCCTATCTACCGATACGGAAATTGATGAGAGATATTACAAAAATTATCTCTGT
GATTGTATTTCAAAATCTTATGAAATAAGATACTCACCATTTAGTCAATCTTCAAAGATTGAAGACGGCT
ATTTTTGGAAAAATGCAAAATGTGAGGTGAATGCCTAA