Summary Sequence Context  
1 homologue found:

HomologuedndE
OrganismCitrobacter koseri ATCC BAA-895
GID1097
PID2097
Locus tagCKO_03495
Locations3256789..3257136
Length348 bp
G+C%37.6
Link NCBI: gi:157144296  
SequenceATGTTACCTAATCGTTTGCAACTGAACATTCGTGTTGAAGATCAACTTAAAAGACTAAAAGCTAGCACGG
GGGTTAATCCAAATATTTCTGCTCGGATAGCATTTTTCCGTTCTGTAGAAAGTGGCTATCGTTTTGACGG
AAATGACTATAAAACTGATGGCAATATGAGTATGGATAAAGCTGTATGGTTGGGAGATACAGGTGTAGCT
ACTGAACTTATATTGAAGATGTTGTATCCCAATTTTGATGGAAAAAAAATGATGCAAGCTTGGGCTGCAC
ATGTTGACGATGGGTCTGCATCCTTGCGAAACCATCGTGAATTAATTAGTTTTACTACATCTCTTTAA