Summary Sequence Alignment 16S rRNA Context  
5 homologues found:

HomologuedndA
OrganismMycobacterium abscessus ATCC 19977
GID1098
PID2098
Locus tagMAB_1093c
Locations1104494..1105693
Length1200 bp
G+C%61.5
Link NCBI: gi:169627108   
SequenceATGACGGTAGACACGCCCACCGACAACCCGACCCAATTGCGATTTTCCGACAAGGAAACCGCAGGTCGGG
TGGTCTACCTGGATTCCAATGCCACGACGCCGGTCGACCCACGGGTGGCCGACGAGGTGTTGACGTACAT
GGCCCGCGAGTTCGGGAACGCCGGCAGTCGCACACACGGATATGGCCAGGTGGCGAAGGAGCGAGTCGCC
CGTGCCCGCGAGCAGGTCGCGGAGGTAGTCCGCGCCCAGCCGGACGATGTGATATTCACCAGTGGCGCCA
CCGAGAGCAACAACCTCGCAATCCTCGGATTGGCCCCGTCAGGCGAGAAGGCGAACCGACGACATATAGT
GTCCACCCAGATTGAGCACAAGGCAGTCCTAGAGCCGCTCGCGATCCTCACGGATCGCGGCTTTGAGGTC
ACGCTCGTGCCGCCGACGCGTGGAGGGCGGATCGAACCGAGCGCCATTGCCGACGCAGTCCGGCCGGACA
CCCTCTTGGTCTCGACAATGGCCGTCAACAATGAGACCGGCGTGATCCAGCCGATTCCCGAAATCGCCGA
AGTGCTTGCTCCGCACGACGCCTACCTTCACGTAGACGCGGCCCAAGCATTCGGAAAGATCATCGAACCC
CTCCGAAATTCGCGGATCGACATGCTTAGTGTCTCTGGCCACAAAGTGTTTGCCCCGAAGGGCATTGGGG
CGCTCGTGGCGCGGCGACGCGGTTACCGACGCGTGCCATTGCAGCCGCTGATGTTCGGCGGTGGCCAAGA
ACGAGGGCTGCGACCTGGAACACTGCCCGTTGCTTTAATCGCCGGCTTGGGCCTTGCCGCAGAACTCGCC
CTAAAGGAAAACGATGCACGGGCCCGACATGCTCTCGCGCTCAAACATCAAGCACTGAACGCACTTTCAG
AACTGGGTATCCAGGCAAACGGCGATGAAGAGCACACGGTCCCGCACACACTGAACTTCTCGGTGCCCGG
CGTCGACGCGGAAGCCGCGATCGTTGCCCTCAAAGAAGTCGTCGCGATATCGAACGGTTCCGCGTGCACC
TCGCAGAAGTACGAACCTAGCCACGTTCTCGTCGCCGCCGATCTTCCGAAAAAGCAGATAGACGGTGCGC
TCCGCTTCTCATGGAGCCACTTAACCGGGGAAGTGCCCTGGGATGTTGTTGCACAGCGTCTCGCACAACT
GGTGACATGA

HomologuedndB
OrganismMycobacterium abscessus ATCC 19977
GID1099
PID2099
Locus tagMAB_1094
Locations1105796..1106938
Length1143 bp
G+C%61.4
Link NCBI: gi:169627108   
SequenceGTGACGCAGACTCACACCGACGCCCAGTCGCCCACCTCGCCAGTTCGCGCCCGCACGGGTGAATTCGAGT
GGGCATTCCCCGCGATCCGCGGCGTCCAAGCTGGACGCGAGTACTACGTGACGATGTGCCCGCTACGGCT
CATTCCCAGAATGTTCCTGTTCGATGAGGAAGAGTTGACTGCGGAGATGCGGGCACAGCGCACGCTGAAT
AAGGGCCGCGTGCCGGAGATCGCCCGGTACATCGTGGAGAACAGTGATAGCTACGTGTTCTCCGCGCTGA
CGGCGTCGGTGGACGTCGATGTGCGATTCGATCCGCTTGCCACGGATGGTCCAAGCGATCGGGTGGGCAC
GCTCGTAATTCCTATGTCAGCTCGCTTCGTGATCAACGATGGTCAGCACCGGCGCGCGGCCATCCAGCAA
GCACTGGCAGAGAATCCTGCCCTGGGCGACGAGAGTATCGCGATCGTCTTGTTCCTCGATATTGGCCTGG
AGCGCTGCCAGCAGATGTTCGCTGATCTCAACCGCTACGCGGTTCGTCCCGCGAAGTCGATCGGCGTGCT
GTATGACCACCGGGACGAGATGTCCGCGCTGACGAGGCTTGTCGTGTTGCGCTCACCTTTCTTGCGTGAT
CTGACAGAGATGGAGACGTCGAACCTCGCCCAGCGGTCGCGGAAGCTGTTCACGCTGTCAGCGCTACACG
CCGCCACCAAGGCGCTTCTCGACGGTATCGAGGAGAGCAACTTCGAGCGTCGAGTCGATCTCGCTTCGAA
GTACTGGGAACTGGTGATCGGTCAATTTCCTGAGTGGGACCAGGTTTTCAACCGCGAGATAACCGCGGGC
GAAGTGCGCCGAGACTTCATTCATACGCACGGAATCGTGCTGCACGCCCTCGGCAAAGTGGGGAACAGTC
TGCTGAGTCAGGGCAAAGGAGTCCGGTCTTGGTCGCCTGCCTTGAAGAAGCTGCGGGACGTGGACTGGCA
CCGCGCAAGCAGTACGTGGGAGGGCCGCGCCGTCATTGGCGGCCGTGTGTCGAAGAGCGCGGCCAACGTC
CTGCTCACCACTGCGGCGATGCGCGCAGTTATGGGATTGCCGCTGCCGCCTGATGAGCAGCGTGCGGAAG
ACGTATTTGGAGGAGGGAATTAA

HomologuedndC
OrganismMycobacterium abscessus ATCC 19977
GID1100
PID2100
Locus tagMAB_1095
Locations1106939..1108477
Length1539 bp
G+C%57.9
Link NCBI: gi:169627108   
SequenceGTGAAGCGAAGTCTGCCTATTACGCCGAAGCGGCGTTCGGCCTTTGATGAGTTGGGGTTTTCGGCGACCG
TGGAGGCGGTCGTCCGTCAGGCGCAGGAACTTTATGCGGCCGATAACGTGCCGTGGGTCGTCGGATATTC
GGGTGGCAAGGATTCGACTGCTGTCCTGCAGATAGTGTGGATGGCCCTGCAGGGATTGCCCAAGAAGCAA
CGGCACAAGCCCGTTCATGTAATCAGTACAGACACGCTGGTCGAAAACCCGGTGGTCGCCTCCTGGGTGA
CACATTCGCTCGAAGTGATGGAAGCCGCCGCAGTCAAGAGCGAGCTCCCCCTGACTCCTCACCGACTCAC
TCCTGCGGTCGCGGACACGTTTTGGGTCAACTTGATCGGTCGCGGCTATCCGGCGCCGAGACCGAAGTTT
CGATGGTGCACAGAACGGCTGAAGATCAAGCCATCGAATACCTTTATCCGCGACATGGTGACGACGCACG
GTGAAGCGATCCTGGTGCTCGGTACCAGGAAAGCCGAAAGTTCCGGACGGTCCCACCGGATGACGGAATT
GGAGGCCCGTCGTGTCCGAGATCTACTGAGTCCCAATAACTCGCTACCGAACTGCCTTGTGTACTCACCG
GTTGAGGACTGGTCCAACGATGACGTGTGGACGTTCCTGATGCAGGAAGCAAATCCGTGGGGCTATTCCA
ATAAGGAACTGCTGACGATGTACCAGGGTGCTTCACCAGACGGTGAGTGCCCGCTGGTTGTCGATTCCAG
CACACCTAGTTGCGGAGATAGCCGATTCGGCTGCTGGACTTGCACATTGGTCGACAAGGACAAGTCGATG
TCGGCGATGATCCAGAACGACGAGGAGAAAGAATGGATGCTCCCGCTGCTGGATCTTCGAAATGCACTCG
ACGTCGCTGATGACAGACATCTGCGTGACTTCCGGCGGATGAACGGTTCGGTGCAGCTTTTCCATGGCAA
ACCGATCCCCGGTCCCTACACGCAGGACTCGCGTGAAGACTGGCTGCGTAGACTGCTTGATGCACAAGCA
TTTATCCGTGCAGAAGGTCCCGACTACGTTCGATCTCTGGATCTGATCACGCAGGCCGAGCTGGACGAGA
TCCGTCGCATATGGGTGGTCGAGAAGCATGAGTTTGAGGACCACTTGCCTGCGATCTACGAGCGTGCAAT
GGGTGTTCCCTATCCGGGCCGACCCTTGGATGAGCACCTGCCGCTCGGACCTGAACTGATCGACACGCTG
CGCGAAGTGACGGGTGGCGATCGTTTGCACTTTGAACTTGTCCGGGAACTCCTTGACGTCGAGCAACGGT
ATCGCACCCAATCGCGCCGCGCAGGACTGTTTGACTCTTTGGAGGCGGCCATTCGGCGGAACTTCTACGA
CGATCAGGACGACGCCCTTTCGAGGGCGCAACGCCGGAAAGCAGCCATGGATCGCAGTGGTGGGCAGACG
GACGGACCCGATCCTTTGGATATCGCGGATGGCTATGTACGGCACGCTGAATCGGAGTTGGTGCAATGA

HomologuedndD
OrganismMycobacterium abscessus ATCC 19977
GID1101
PID2101
Locus tagMAB_1096
Locations1108474..1110450
Length1977 bp
G+C%61.9
Link NCBI: gi:169627108   
SequenceATGATTCTCGATAACTTGGTGTTGGAGAACATCGGCACCTTCGGCGGCAAGAACGAAATCCGTCTCACGC
CATCCTCGTCTAAGAAGCCGGTGGTGCTGATTGGCGGCCTGAACGGTGCTGGCAAGACGACAATTCTCGA
AGCTATCCACCTCGCGCTGTACGGGCCGTTGTCACAAGCCCGAAGTCGACGCAGCGGCAGCTACGACACG
TACTTGCGAAGCCTGATACACCACGGCGTGCCAGCCTCGGAGGGCGCAGCAGTTGAGCTGAGCTTTCACC
TCTTCCAACAAGGGGAGGAGCACTCGTACCGGATTAGGCGACGATGGCAAGGCGGCGGTGCGTCGCTACA
AGAGTTTGTGCTCGTGTGGGTCGACGGCAAGTATGACGATGCGTTGACATCCACATGGAACGAACATGTG
GAAACGTTCATCCCGCGCGGGATCGCGGGACTGTTCTTCTTCGATGGCGAGCAGATCGAAGCCCTCGCTG
ATTTGGAGCAATCCCAACATGTACTCAAGTCAGCGCTCGCCGCTCTCCTTGGCCTCGATCTGATCGACCG
TCTATCTACAGATCTCGCCGTGTTGCGGCGGCGCCACCGCGGCGCTGAGGTTCCCGATGACTTGCGGCTG
GCTGTTGAAGAGCGGCGCAAAACCGTCACGTTGGCTCGTCAGGGTGAGGAGATGGCCGCGACGTTGGCAG
CGACGTCGCGGGTGGAGGCAGAACGGGCGGACAAGCGCCTTAACGAAGTCACTGAGCAGTACCGGGCGGC
CGGAGGCGGTCTGCTTGAACAACGAGACGCCGCGAACACGCGGGTGACTTTAGTGCGACAACAGATCGCT
GACCTTGACGATGAGCTTCGCGCGGAAGCGGCTGATACCGCTCCCTTCCTCCTGGTCGGAGGCCTGCTGG
GTGATCTGGCCAATCATGTGGCACGCGAGCGGGACGCGCGCCGCGATTCGCTGGTGCTGAGCGTCGTGGG
CGACCGCGATCGCGAGCTATTGGGACTGCTGCGCAAGGCAAAGGTTCGGGGAGCGGCGCTCACCGCGCTG
GAAGAGTTCATGGCTTCGGATGTCGCGTCTCGCCAGGATGCATCGGCGCGCGTCCCGATGGTGAGCGGGC
TACGCGATGGGGGACCTGTCGAGGCCCTACACGCAAGCGTCCTACCGTCGACACAGAATCGTGTAGCGAG
CCTGGTGGAACGGCGGGTCGCGCTCGCCGAAGAACTGGTGCAGGCCGAGCGAACGCTGGTTGCCATTCCA
GATCCGGAATCGCTCGCATCACTCAAGCAGGAACTTGATGAGGCGTCCGAAGCCGCTGTGAGGTGTCACG
CGCTTCTCGTCCAGAACGAGGATCAGCTCGAAGCATCGCGCCAGGAGCGCGCTCGTGCCGACAGCGCATA
CGAAGCCGCGATGGACAAGTCGGCACAGGCAACACTCGACGCCGACGATGATCGCCGCCTGGTTGAGCAC
GCCGAGCGGGCTCGTGTGACCCTGGATGAGCTGAAGACCAAGGCTGCCGAGCGGCACGTCAGCCAGATTG
GTCGCCTGGTACTCGAAGCACTCACCAGGCTTCTCCGCAAAGACCGCCTCGTCACCGACGTTCGCATTGA
CCCGACGTCATACACCGTTGAGTTGGTCGGTTCTGATGGTCAGAGTCTCGCGGCAACGGAGCTGTCTGCC
GGCGAGCGGCAGCTCTTGGCGGTGGCACTTCTGTGGGGACTTGCCCAGGCGGCCGGCCAACCGCTGCCGA
TGGTCATTGACACACCACTCGGCCGGCTAGACGGTGCGCATCGAGGTCGGCTCATCGAACGGTACTTTCC
GCATGCGGCTCATCAGGTCGTGTTGCTGTCGACCGACACTGAAGTCGACGAAGCGGCATTGAAATCGTTG
CGGCCGTCCGTCGGGAGGATGTACCGGCTGGAGTTCGATAGCGCTGTTAACGCCACGACGGTTCAACTCG
GATATTTTTGGGAGTGA

HomologuedndE
OrganismMycobacterium abscessus ATCC 19977
GID1102
PID2102
Locus tagMAB_1097
Locations1110453..1110845
Length393 bp
G+C%59.7
Link NCBI: gi:169627108   
SequenceATGAGCATCGAGCACATCCGGTTGACGACAACGGCTCGCGACCAGCTAGTCACTCTGAAACGTCGAACCG
GCATCACACAGTGGAATGTCCTGTGCCGCTGGGCGCTCTGCCGTTCTTTGGGGGAGTCTGCACCGCCTCC
TGTGGCGAAGCTGGTGTTCGACAGCAATGTGGAGATGACATGGCGGGTGTTCGCCGGGGAACACGGCGAC
GAGTTGCTCGCGCTGGTGCGCTATCGCTGTCACGTCGACGGATTAGCCACGGATGACGACACGATTGGGC
AGCAGCTCCGTCTCCATCTTCATCGCGGGATTGGCTATCTGGTTGGTGATCCGCGTGTCACTAACATTGC
GGGACTTGCCTCTCTTGTACTGGAACAGCCGCCAGCGGCATGA