Summary Sequence Context  
1 homologue found:

HomologuedndA
OrganismMycobacterium abscessus ATCC 19977
GID1098
PID2098
Locus tagMAB_1093c
Locations1104494..1105693
Length1200 bp
G+C%61.5
Link NCBI: gi:169627108   
SequenceATGACGGTAGACACGCCCACCGACAACCCGACCCAATTGCGATTTTCCGACAAGGAAACCGCAGGTCGGG
TGGTCTACCTGGATTCCAATGCCACGACGCCGGTCGACCCACGGGTGGCCGACGAGGTGTTGACGTACAT
GGCCCGCGAGTTCGGGAACGCCGGCAGTCGCACACACGGATATGGCCAGGTGGCGAAGGAGCGAGTCGCC
CGTGCCCGCGAGCAGGTCGCGGAGGTAGTCCGCGCCCAGCCGGACGATGTGATATTCACCAGTGGCGCCA
CCGAGAGCAACAACCTCGCAATCCTCGGATTGGCCCCGTCAGGCGAGAAGGCGAACCGACGACATATAGT
GTCCACCCAGATTGAGCACAAGGCAGTCCTAGAGCCGCTCGCGATCCTCACGGATCGCGGCTTTGAGGTC
ACGCTCGTGCCGCCGACGCGTGGAGGGCGGATCGAACCGAGCGCCATTGCCGACGCAGTCCGGCCGGACA
CCCTCTTGGTCTCGACAATGGCCGTCAACAATGAGACCGGCGTGATCCAGCCGATTCCCGAAATCGCCGA
AGTGCTTGCTCCGCACGACGCCTACCTTCACGTAGACGCGGCCCAAGCATTCGGAAAGATCATCGAACCC
CTCCGAAATTCGCGGATCGACATGCTTAGTGTCTCTGGCCACAAAGTGTTTGCCCCGAAGGGCATTGGGG
CGCTCGTGGCGCGGCGACGCGGTTACCGACGCGTGCCATTGCAGCCGCTGATGTTCGGCGGTGGCCAAGA
ACGAGGGCTGCGACCTGGAACACTGCCCGTTGCTTTAATCGCCGGCTTGGGCCTTGCCGCAGAACTCGCC
CTAAAGGAAAACGATGCACGGGCCCGACATGCTCTCGCGCTCAAACATCAAGCACTGAACGCACTTTCAG
AACTGGGTATCCAGGCAAACGGCGATGAAGAGCACACGGTCCCGCACACACTGAACTTCTCGGTGCCCGG
CGTCGACGCGGAAGCCGCGATCGTTGCCCTCAAAGAAGTCGTCGCGATATCGAACGGTTCCGCGTGCACC
TCGCAGAAGTACGAACCTAGCCACGTTCTCGTCGCCGCCGATCTTCCGAAAAAGCAGATAGACGGTGCGC
TCCGCTTCTCATGGAGCCACTTAACCGGGGAAGTGCCCTGGGATGTTGTTGCACAGCGTCTCGCACAACT
GGTGACATGA