Summary Sequence Context  
1 homologue found:

HomologuedndB
OrganismMycobacterium abscessus ATCC 19977
GID1099
PID2099
Locus tagMAB_1094
Locations1105796..1106938
Length1143 bp
G+C%61.4
Link NCBI: gi:169627108   
SequenceGTGACGCAGACTCACACCGACGCCCAGTCGCCCACCTCGCCAGTTCGCGCCCGCACGGGTGAATTCGAGT
GGGCATTCCCCGCGATCCGCGGCGTCCAAGCTGGACGCGAGTACTACGTGACGATGTGCCCGCTACGGCT
CATTCCCAGAATGTTCCTGTTCGATGAGGAAGAGTTGACTGCGGAGATGCGGGCACAGCGCACGCTGAAT
AAGGGCCGCGTGCCGGAGATCGCCCGGTACATCGTGGAGAACAGTGATAGCTACGTGTTCTCCGCGCTGA
CGGCGTCGGTGGACGTCGATGTGCGATTCGATCCGCTTGCCACGGATGGTCCAAGCGATCGGGTGGGCAC
GCTCGTAATTCCTATGTCAGCTCGCTTCGTGATCAACGATGGTCAGCACCGGCGCGCGGCCATCCAGCAA
GCACTGGCAGAGAATCCTGCCCTGGGCGACGAGAGTATCGCGATCGTCTTGTTCCTCGATATTGGCCTGG
AGCGCTGCCAGCAGATGTTCGCTGATCTCAACCGCTACGCGGTTCGTCCCGCGAAGTCGATCGGCGTGCT
GTATGACCACCGGGACGAGATGTCCGCGCTGACGAGGCTTGTCGTGTTGCGCTCACCTTTCTTGCGTGAT
CTGACAGAGATGGAGACGTCGAACCTCGCCCAGCGGTCGCGGAAGCTGTTCACGCTGTCAGCGCTACACG
CCGCCACCAAGGCGCTTCTCGACGGTATCGAGGAGAGCAACTTCGAGCGTCGAGTCGATCTCGCTTCGAA
GTACTGGGAACTGGTGATCGGTCAATTTCCTGAGTGGGACCAGGTTTTCAACCGCGAGATAACCGCGGGC
GAAGTGCGCCGAGACTTCATTCATACGCACGGAATCGTGCTGCACGCCCTCGGCAAAGTGGGGAACAGTC
TGCTGAGTCAGGGCAAAGGAGTCCGGTCTTGGTCGCCTGCCTTGAAGAAGCTGCGGGACGTGGACTGGCA
CCGCGCAAGCAGTACGTGGGAGGGCCGCGCCGTCATTGGCGGCCGTGTGTCGAAGAGCGCGGCCAACGTC
CTGCTCACCACTGCGGCGATGCGCGCAGTTATGGGATTGCCGCTGCCGCCTGATGAGCAGCGTGCGGAAG
ACGTATTTGGAGGAGGGAATTAA