Summary Sequence Context  
1 homologue found:

HomologuedndC
OrganismMycobacterium abscessus ATCC 19977
GID1100
PID2100
Locus tagMAB_1095
Locations1106939..1108477
Length1539 bp
G+C%57.9
Link NCBI: gi:169627108   
SequenceGTGAAGCGAAGTCTGCCTATTACGCCGAAGCGGCGTTCGGCCTTTGATGAGTTGGGGTTTTCGGCGACCG
TGGAGGCGGTCGTCCGTCAGGCGCAGGAACTTTATGCGGCCGATAACGTGCCGTGGGTCGTCGGATATTC
GGGTGGCAAGGATTCGACTGCTGTCCTGCAGATAGTGTGGATGGCCCTGCAGGGATTGCCCAAGAAGCAA
CGGCACAAGCCCGTTCATGTAATCAGTACAGACACGCTGGTCGAAAACCCGGTGGTCGCCTCCTGGGTGA
CACATTCGCTCGAAGTGATGGAAGCCGCCGCAGTCAAGAGCGAGCTCCCCCTGACTCCTCACCGACTCAC
TCCTGCGGTCGCGGACACGTTTTGGGTCAACTTGATCGGTCGCGGCTATCCGGCGCCGAGACCGAAGTTT
CGATGGTGCACAGAACGGCTGAAGATCAAGCCATCGAATACCTTTATCCGCGACATGGTGACGACGCACG
GTGAAGCGATCCTGGTGCTCGGTACCAGGAAAGCCGAAAGTTCCGGACGGTCCCACCGGATGACGGAATT
GGAGGCCCGTCGTGTCCGAGATCTACTGAGTCCCAATAACTCGCTACCGAACTGCCTTGTGTACTCACCG
GTTGAGGACTGGTCCAACGATGACGTGTGGACGTTCCTGATGCAGGAAGCAAATCCGTGGGGCTATTCCA
ATAAGGAACTGCTGACGATGTACCAGGGTGCTTCACCAGACGGTGAGTGCCCGCTGGTTGTCGATTCCAG
CACACCTAGTTGCGGAGATAGCCGATTCGGCTGCTGGACTTGCACATTGGTCGACAAGGACAAGTCGATG
TCGGCGATGATCCAGAACGACGAGGAGAAAGAATGGATGCTCCCGCTGCTGGATCTTCGAAATGCACTCG
ACGTCGCTGATGACAGACATCTGCGTGACTTCCGGCGGATGAACGGTTCGGTGCAGCTTTTCCATGGCAA
ACCGATCCCCGGTCCCTACACGCAGGACTCGCGTGAAGACTGGCTGCGTAGACTGCTTGATGCACAAGCA
TTTATCCGTGCAGAAGGTCCCGACTACGTTCGATCTCTGGATCTGATCACGCAGGCCGAGCTGGACGAGA
TCCGTCGCATATGGGTGGTCGAGAAGCATGAGTTTGAGGACCACTTGCCTGCGATCTACGAGCGTGCAAT
GGGTGTTCCCTATCCGGGCCGACCCTTGGATGAGCACCTGCCGCTCGGACCTGAACTGATCGACACGCTG
CGCGAAGTGACGGGTGGCGATCGTTTGCACTTTGAACTTGTCCGGGAACTCCTTGACGTCGAGCAACGGT
ATCGCACCCAATCGCGCCGCGCAGGACTGTTTGACTCTTTGGAGGCGGCCATTCGGCGGAACTTCTACGA
CGATCAGGACGACGCCCTTTCGAGGGCGCAACGCCGGAAAGCAGCCATGGATCGCAGTGGTGGGCAGACG
GACGGACCCGATCCTTTGGATATCGCGGATGGCTATGTACGGCACGCTGAATCGGAGTTGGTGCAATGA